HUGE

Gene/Protein Characteristic Table for KIAA1066

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00728
Accession No. :	AB028989
Description :	C-jun-amino-terminal kinase-interacting protein 3.
HUGO Gene Name :	mitogen-activated protein kinase 8 interacting protein 3 (MAPK8IP3)
Clone Name :	ah03682 [Vector Info]
Flexi ORF Clone :	pF1KSDA1066
Source :	Human brain (amygdala)
Note :	We replaced hj05363b, former representative clones for KIAA1066 with ah03682. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1490 bp

Genome contig ID gi51511732f_1596222
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATATCTGCTCTGTATGTAATAAATGTCTTAACGTC
Flanking genome sequence
(164096 - 164145)
----+----*----+----*----+----*----+----*----+----*
GTAGCTGCCTGTTCCTGGGCCCAAATCGAAACGAAAACGAGGACTTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 1696222 1760316 31 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1346 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPT6	100.0	C-jun-amino-ter...	Homo sapiens
AAI44487	99.8	MAPK8IP3 protei...	Homo sapiens
EAW85631	99.6	mitogen-activat...	Homo sapiens
NP_001035529	99.6	mitogen-activat...	Homo sapiens
EAW85632	99.4	mitogen-activat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011088	2.3e-86	57.1	KIAA0516
AB002335	2e-09	24.0	KIAA0337
AB046846	1.5e-08	30.7	KIAA1626
AB002292	5.1e-07	30.0	KIAA0294

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTATGTCCGCTCCCTCGTC

Primer_r
: TATGTGGGTTTGCTTGCAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTATGTCCGCTCCCTCGTC
Primer_r	: TATGTGGGTTTGCTTGCAGGG
PCR product length	: 124 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1490 bp
Genome contig ID	gi51511732f_1596222
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATATCTGCTCTGTATGTAATAAATGTCTTAACGTC
Flanking genome sequence (164096 - 164145)	----+--------+--------+--------+--------+----* GTAGCTGCCTGTTCCTGGGCCCAAATCGAAACGAAAACGAGGACTTTATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	1696222	1760316	31	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1066

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information