| HUGE |
Gene/Protein Characteristic Table for KIAA0475 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00545 |
|---|---|
| Accession No. : | AB007944 |
| Description : | Protein FAM20B precursor. |
| HUGO Gene Name : | family with sequence similarity 20, member B (FAM20B) |
| Clone Name : | hh00451 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0475
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5983 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4417 bp Genome contig ID gi89161185f_177179470 PolyA signal sequence
(AATAAA,-7) +----*----+----*----+----*----+----
CTGAAAAAAGAAAATGAATAAAGATTTTAATAAATFlanking genome sequence
(132852 - 132901) ----+----*----+----*----+----*----+----*----+----*
ATTGATATCTGATCTTTTCCTCTTCTTTCCCCCTTCAGGATATTTCCAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 177261654 177312320 8 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 438 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : ATCAAAAGAGAGGGTAGTGGC | |
| : GGTGAAACTGGGAACAACTAC | |
| : 81 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |