ROUGE |
Gene/Protein Characteristic Table for mKIAA0475 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129154 |
---|---|
Protein FAM20B precursor. | |
mph00319 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3672 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2865 bp Genome contig ID gi65488608r_156484140 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TTCAATTCTGAAAAAAAAATAAAAGATTTTAATATFlanking genome sequence
(99975 - 99926) ----+----*----+----*----+----*----+----*----+----*
ATATTATTGTATAATGTCTTCTGGTTAATCTCCCCCCACCCCCAACCCCA
KIAA Alignment based on: KIAA0475 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..807
Length: 268 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |