| HUGE |
Gene/Protein Characteristic Table for KIAA0407 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01666 |
|---|---|
| Accession No. : | AB007867 |
| Description : | Plexin-B1 precursor. |
| HUGO Gene Name : | plexin B1 (PLXNB1) |
| Clone Name : | hg01339 [Vector Info] |
| Flexi ORF Clone : | pF1KA0407
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7308 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2143 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001627 | 43 | 470 | PF01403 | Semaphorin/CD100 antigen |
| IPR002165 | 489 | 542 | PF01437 | Plexin | |
| IPR002165 | 1029 | 1076 | PF01437 | Plexin | |
| IPR002909 | 1078 | 1167 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR002909 | 1170 | 1256 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR002909 | 1260 | 1382 | PF01833 | Cell surface receptor IPT/TIG | |
| IPR013548 | 1569 | 2110 | PF08337 | Plexin cytoplasmic region | |
| HMMSmart | IPR001627 | 43 | 471 | SM00630 | Semaphorin/CD100 antigen |
| IPR003659 | 489 | 542 | SM00423 | Plexin/semaphorin/integrin | |
| IPR003659 | 636 | 686 | SM00423 | Plexin/semaphorin/integrin | |
| IPR003659 | 1029 | 1076 | SM00423 | Plexin/semaphorin/integrin | |
| IPR002909 | 1077 | 1168 | SM00429 | Cell surface receptor IPT/TIG | |
| IPR002909 | 1169 | 1257 | SM00429 | Cell surface receptor IPT/TIG | |
| IPR002909 | 1259 | 1383 | SM00429 | Cell surface receptor IPT/TIG | |
| ProfileScan | IPR001627 | 17 | 487 | PS51004 | Semaphorin/CD100 antigen |
| ScanRegExp | IPR003006 | 1028 | 1034 | PS00290 | Immunoglobulin/major histocompatibility complex motif |
| IPR002345 | 1829 | 1841 | PS00213 | Lipocalin |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| SOSUI2 | 1 | 7 | VTMPALGPALLQALWAGWVLTLQ | 29 | SECONDARY | 23 |
| 2 | 1494 | PVAAQVGLGVGTSLLALGVIIIV | 1516 | PRIMARY | 23 |
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : AAAAGCTGGGTCAATGGAGTC | |
| : TTGCTGCTGCCACATCCTAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : GeneBridge 4 | |
| : AAAAGCTGGGTCAATGGAGTC | |
| : TTGCTGCTGCCACATCCTAGG | |
| : 176 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
