| HUGE |
Gene/Protein Characteristic Table for KIAA1550 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06405 |
|---|---|
| Accession No. : | AB046770 |
| Description : | Plexin-A4 precursor. |
| HUGO Gene Name : | plexin A4 (PLXNA4) |
| Clone Name : | ff03434 [Vector Info] |
| Source : | Human fetal brain |
| Note : | We replaced fh16159 and fh16159s1, former representative clones for KIAA1550 with ff03434. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 11518 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 7127 bp Genome contig ID gi89161213r_131358640 PolyA signal sequence
(AATAAA,-11) +----*----+----*----+----*----+----
ATAGAATAAAGTTTATTAAAAAATAATAAAAATGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTTTGGGATTTTGGGTGCTTCTTTATGTGACTGGCTAGGAGGGGCTGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 131458640 131824667 30 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1462 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CTAGAGATGAAGGTGTCGGTG | |
| : ATCTGGGGGTTCTGTATGAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : CCR | |
| : CTAGAGATGAAGGTGTCGGTG | |
| : ATCTGGGGGTTCTGTATGAGG | |
| : 176(2k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |