HUGE

Gene/Protein Characteristic Table for KIAA0323

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00505
Accession No. :	AB002321
Description :
HUGO Gene Name :
Clone Name :	hg00467 [Vector Info]
Flexi ORF Clone :	pF1KSDA0323
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6227 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4051 bp

Genome contig ID gi51511730f_23868332
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTGTTGTAAGGAATAAATGATAATAAGCATAAAAC
Flanking genome sequence
(112050 - 112099)
----+----*----+----*----+----*----+----*----+----*
ACTTCAAATAGTGGCTGGTGTGTATAATTGTTTGCAATTACTTGGTCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 23968332 23980380 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF84369	0	99.9	unnamed protein...	Homo sapiens
CAD61924	0	99.7	unnamed protein...	Homo sapiens
AAI51401	1.8e-204	81.9	LOC100124517 pr...	Bos taurus
EDL36230	4.2e-195	78.3	RIKEN cDNA 9130...	Mus musculus
BAC27665	9.4e-155	78.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037726	1.9e-28	62.6	KIAA1305
AB014515	1.3e-25	30.5	KIAA0615
AB051513	1.1e-16	46.6	KIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGGTCATGGAGAAGTTCAAGG

Primer_r
: GTAGTAAGCTGCCGGTGGAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGTCATGGAGAAGTTCAAGG
Primer_r	: GTAGTAAGCTGCCGGTGGAAC
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4051 bp
Genome contig ID	gi51511730f_23868332
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTGTTGTAAGGAATAAATGATAATAAGCATAAAAC
Flanking genome sequence (112050 - 112099)	----+--------+--------+--------+--------+----* ACTTCAAATAGTGGCTGGTGTGTATAATTGTTTGCAATTACTTGGTCCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	23968332	23980380	8	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0323

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information