HUGE

Gene/Protein Characteristic Table for KIAA1305

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05651
Accession No. :	AB037726
Description :
HUGO Gene Name :
Clone Name :	fh04045s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh04045, former representative clones for KIAA1305 with fh04045s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1836 bp

Genome contig ID gi51511730f_23846954
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTCATTTGATTTGTCAATAAACGAATCAAACTGG
Flanking genome sequence
(111376 - 111425)
----+----*----+----*----+----*----+----*----+----*
AGCTGATGTCCAGTTCTTTGTTTAGCTTCAGTCTCAATTGTGGGAATGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 23946954 23958328 7 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1819 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001056534	75.3	similar to CG10...	Rattus norvegicus
EAW66019	100.0	hCG40187, isofo...	Homo sapiens
XP_001104789	95.3	similar to CG10...	Macaca mulatta
XP_547747	84.8	similar to CG10...	Canis lupus fam...
XP_001476349	75.1	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002321	1.2e-19	62.6	KIAA0323
AB014515	2.3e-14	49.5	KIAA0615
AB051513	4e-08	46.9	KIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001584 1530 1598 PF00665 Integrase

ProfileScan IPR001584 1530 1651 PS50994 Integrase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001584	1530	1598	PF00665	Integrase
ProfileScan	IPR001584	1530	1651	PS50994	Integrase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTCCACTGTATCCTGCATC

Primer_r
: AACTCACACTCACTGCAAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1836 bp
Genome contig ID	gi51511730f_23846954
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTCATTTGATTTGTCAATAAACGAATCAAACTGG
Flanking genome sequence (111376 - 111425)	----+--------+--------+--------+--------+----* AGCTGATGTCCAGTTCTTTGTTTAGCTTCAGTCTCAATTGTGGGAATGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	23946954	23958328	7	99.4	Perfect prediction

Primer_f	: ACCTCCACTGTATCCTGCATC
Primer_r	: AACTCACACTCACTGCAAGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1305

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information