| HUGE |
Gene/Protein Characteristic Table for KIAA0311 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00049 |
|---|---|
| Accession No. : | AB002309 |
| Description : | A-kinase anchor protein 6. |
| HUGO Gene Name : | A kinase (PRKA) anchor protein 6 (AKAP6) |
| Clone Name : | hg00112s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0311
![]() |
| Source : | Human adult brain |
| Note : | We replaced hg00112, former representative clones for KIAA0311 with hg00112s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 10327 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3257 bp Genome contig ID gi51511730f_31768290 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
ATTGTAAATTTCAAACAATAAATAAATAAGAATCCFlanking genome sequence
(603730 - 603779) ----+----*----+----*----+----*----+----*----+----*
ATGACTTCCTTCAGTGGCCCAGTCCAGTGCCTAAGTCATCTGGAATCTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 31868290 32372018 14 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2324 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : TCAGTCAGGTTGGAATGGATC | |
| : CTCTTTCTCATGGCAACCCTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 14 |
| : GeneBridge 4 | |
| : TCAGTCAGGTTGGAATGGATC | |
| : CTCTTTCTCATGGCAACCCTG | |
| : 118 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |