ROUGE |
Gene/Protein Characteristic Table for mKIAA0311 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129115 |
---|---|
mbg19192 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5712 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3235 bp Genome contig ID gi65532617f_49794492 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
TAAATTTCAATAAATAAACAAATAAACAAGTGAATFlanking genome sequence
(110755 - 110804) ----+----*----+----*----+----*----+----*----+----*
AAAATAAGAATCCATGACTTCCTTCTGTGGTCCAGGCTAGTGCTGGAGTC
KIAA Alignment based on: KIAA0311 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2477
Length: 824 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |