| HUGE |
Gene/Protein Characteristic Table for KIAA0582 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00567 |
|---|---|
| Accession No. : | AB011154 |
| Description : | Centrosomal protein of 68 kDa. |
| HUGO Gene Name : | |
| Clone Name : | fh15957 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0582
![]() |
| Source : | Human fetal brain |
| Note : | We replaced hj00648, former representative clones for KIAA0582 with fh15957. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5857 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3369 bp Genome contig ID gi89161199f_65036999 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GCCTGTTTAGTGAAAAATAAAAATTAAAAAAACCTFlanking genome sequence
(130644 - 130693) ----+----*----+----*----+----*----+----*----+----*
ATTCATTTTTGGCTTGTGTTTAGCTTAAATTTTATCATTAAATTAAGGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 65136999 65167641 7 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 760 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : ACGGCATGGCATCACAGTATC | |
| : GCAACTGACAAATTCCTGAAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : GeneBridge 4 | |
| : ACGGCATGGCATCACAGTATC | |
| : GCAACTGACAAATTCCTGAAG | |
| : 173 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |