HUGE |
Gene/Protein Characteristic Table for KIAA0302 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00045 |
---|---|
Accession No. : | AB008567 |
Description : | Spectrin beta chain, brain 2. |
HUGO Gene Name : | |
Clone Name : | hf00409s2 [Vector Info] |
Flexi ORF Clone : | pF1KA0302
![]() |
Source : | Human adult brain |
Note : | We replaced hf00409 and hf00409s1, former representative clones for KIAA0302 with hf00409s2. (2006/4/25,2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7864 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 619 bp Genome contig ID gi51511727r_66109299 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
CTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TCACCGCCTCTGGGTGTCTTTGCTTTCCTGACCACAGCCTCTCTGCCCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 66209299 66245446 37 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2414 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001605 | 2245 | 2264 | PR00683 | Spectrin/pleckstrin-like |
IPR001605 | 2265 | 2286 | PR00683 | Spectrin/pleckstrin-like | |
IPR001605 | 2307 | 2324 | PR00683 | Spectrin/pleckstrin-like | |
IPR001605 | 2327 | 2345 | PR00683 | Spectrin/pleckstrin-like | |
HMMPfam | IPR001715 | 82 | 185 | PF00307 | Calponin-like actin-binding |
IPR001715 | 201 | 305 | PF00307 | Calponin-like actin-binding | |
IPR002017 | 329 | 439 | PF00435 | Spectrin repeat | |
IPR002017 | 449 | 553 | PF00435 | Spectrin repeat | |
IPR002017 | 555 | 663 | PF00435 | Spectrin repeat | |
IPR002017 | 665 | 769 | PF00435 | Spectrin repeat | |
IPR002017 | 771 | 874 | PF00435 | Spectrin repeat | |
IPR002017 | 876 | 980 | PF00435 | Spectrin repeat | |
IPR002017 | 982 | 1087 | PF00435 | Spectrin repeat | |
IPR002017 | 1089 | 1194 | PF00435 | Spectrin repeat | |
IPR002017 | 1196 | 1283 | PF00435 | Spectrin repeat | |
IPR002017 | 1302 | 1405 | PF00435 | Spectrin repeat | |
IPR002017 | 1407 | 1510 | PF00435 | Spectrin repeat | |
IPR002017 | 1512 | 1610 | PF00435 | Spectrin repeat | |
IPR002017 | 1612 | 1716 | PF00435 | Spectrin repeat | |
IPR002017 | 1718 | 1823 | PF00435 | Spectrin repeat | |
IPR002017 | 1825 | 1929 | PF00435 | Spectrin repeat | |
IPR002017 | 1931 | 2035 | PF00435 | Spectrin repeat | |
IPR002017 | 2037 | 2099 | PF00435 | Spectrin repeat | |
IPR001849 | 2243 | 2352 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001715 | 83 | 183 | SM00033 | Calponin-like actin-binding |
IPR001715 | 202 | 300 | SM00033 | Calponin-like actin-binding | |
IPR002017 | 332 | 438 | SM00150 | Spectrin repeat | |
IPR002017 | 452 | 552 | SM00150 | Spectrin repeat | |
IPR002017 | 558 | 662 | SM00150 | Spectrin repeat | |
IPR002017 | 668 | 768 | SM00150 | Spectrin repeat | |
IPR002017 | 774 | 873 | SM00150 | Spectrin repeat | |
IPR002017 | 879 | 979 | SM00150 | Spectrin repeat | |
IPR002017 | 985 | 1086 | SM00150 | Spectrin repeat | |
IPR002017 | 1092 | 1193 | SM00150 | Spectrin repeat | |
IPR002017 | 1199 | 1299 | SM00150 | Spectrin repeat | |
IPR002017 | 1305 | 1404 | SM00150 | Spectrin repeat | |
IPR002017 | 1410 | 1509 | SM00150 | Spectrin repeat | |
IPR002017 | 1515 | 1609 | SM00150 | Spectrin repeat | |
IPR002017 | 1615 | 1715 | SM00150 | Spectrin repeat | |
IPR002017 | 1721 | 1822 | SM00150 | Spectrin repeat | |
IPR002017 | 1828 | 1928 | SM00150 | Spectrin repeat | |
IPR002017 | 1934 | 2034 | SM00150 | Spectrin repeat | |
IPR002017 | 2040 | 2280 | SM00150 | Spectrin repeat | |
IPR001849 | 2243 | 2354 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001715 | 81 | 185 | PS50021 | Calponin-like actin-binding |
IPR001715 | 200 | 302 | PS50021 | Calponin-like actin-binding | |
IPR001849 | 2242 | 2352 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR001589 | 83 | 92 | PS00019 | Actin-binding |
IPR001589 | 157 | 181 | PS00020 | Actin-binding |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AGAGCAGCTGGAGATGGAGTG | |
: CCTTCTGCCTTCTGGTTCCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: AGAGCAGCTGGAGATGGAGTG | |
: CCTTCTGCCTTCTGGTTCCTC | |
: 163 bp | |
: 95 °C |
How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage ![]() | |