HUGE

Gene/Protein Characteristic Table for KIAA0302

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00045
Accession No. :	AB008567
Description :	Spectrin beta chain, brain 2.
HUGO Gene Name :
Clone Name :	hf00409s2 [Vector Info]
Flexi ORF Clone :	pF1KA0302
Source :	Human adult brain
Note :	We replaced hf00409 and hf00409s1, former representative clones for KIAA0302 with hf00409s2. (2006/4/25,2008/8/27)

Features of the cloned DNA sequence	Description

Length: 7864 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 619 bp

Genome contig ID gi51511727r_66109299
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCACCGCCTCTGGGTGTCTTTGCTTTCCTGACCACAGCCTCTCTGCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 66209299 66245446 37 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32700	100.0	beta-spectrin I...	Homo sapiens
O15020	100.0	Spectrin beta c...	Homo sapiens
XP_508579	99.4	spectrin, beta,...	Pan troglodytes
XP_001108262	98.7	spectrin, beta,...	Macaca mulatta
EAW74560	99.0	spectrin, beta,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046862	4.2e-106	42.7	KIAA1642
AB018271	3.7e-07	21.5	KIAA0728
AB037785	8.1e-06	43.4	KIAA1364
AB018293	1.2e-05	29.8	KIAA0750
AB020710	0.00018	23.3	KIAA0903

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001605 2245 2264 PR00683 Spectrin/pleckstrin-like

IPR001605 2265 2286 PR00683 Spectrin/pleckstrin-like

IPR001605 2307 2324 PR00683 Spectrin/pleckstrin-like

IPR001605 2327 2345 PR00683 Spectrin/pleckstrin-like

HMMPfam IPR001715 82 185 PF00307 Calponin-like actin-binding

IPR001715 201 305 PF00307 Calponin-like actin-binding

IPR002017 329 439 PF00435 Spectrin repeat

IPR002017 449 553 PF00435 Spectrin repeat

IPR002017 555 663 PF00435 Spectrin repeat

IPR002017 665 769 PF00435 Spectrin repeat

IPR002017 771 874 PF00435 Spectrin repeat

IPR002017 876 980 PF00435 Spectrin repeat

IPR002017 982 1087 PF00435 Spectrin repeat

IPR002017 1089 1194 PF00435 Spectrin repeat

IPR002017 1196 1283 PF00435 Spectrin repeat

IPR002017 1302 1405 PF00435 Spectrin repeat

IPR002017 1407 1510 PF00435 Spectrin repeat

IPR002017 1512 1610 PF00435 Spectrin repeat

IPR002017 1612 1716 PF00435 Spectrin repeat

IPR002017 1718 1823 PF00435 Spectrin repeat

IPR002017 1825 1929 PF00435 Spectrin repeat

IPR002017 1931 2035 PF00435 Spectrin repeat

IPR002017 2037 2099 PF00435 Spectrin repeat

IPR001849 2243 2352 PF00169 Pleckstrin-like

HMMSmart IPR001715 83 183 SM00033 Calponin-like actin-binding

IPR001715 202 300 SM00033 Calponin-like actin-binding

IPR002017 332 438 SM00150 Spectrin repeat

IPR002017 452 552 SM00150 Spectrin repeat

IPR002017 558 662 SM00150 Spectrin repeat

IPR002017 668 768 SM00150 Spectrin repeat

IPR002017 774 873 SM00150 Spectrin repeat

IPR002017 879 979 SM00150 Spectrin repeat

IPR002017 985 1086 SM00150 Spectrin repeat

IPR002017 1092 1193 SM00150 Spectrin repeat

IPR002017 1199 1299 SM00150 Spectrin repeat

IPR002017 1305 1404 SM00150 Spectrin repeat

IPR002017 1410 1509 SM00150 Spectrin repeat

IPR002017 1515 1609 SM00150 Spectrin repeat

IPR002017 1615 1715 SM00150 Spectrin repeat

IPR002017 1721 1822 SM00150 Spectrin repeat

IPR002017 1828 1928 SM00150 Spectrin repeat

IPR002017 1934 2034 SM00150 Spectrin repeat

IPR002017 2040 2280 SM00150 Spectrin repeat

IPR001849 2243 2354 SM00233 Pleckstrin-like

ProfileScan IPR001715 81 185 PS50021 Calponin-like actin-binding

IPR001715 200 302 PS50021 Calponin-like actin-binding

IPR001849 2242 2352 PS50003 Pleckstrin-like

ScanRegExp IPR001589 83 92 PS00019 Actin-binding

IPR001589 157 181 PS00020 Actin-binding

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	2245	2264	PR00683	Spectrin/pleckstrin-like
IPR001605	2265	2286	PR00683	Spectrin/pleckstrin-like
IPR001605	2307	2324	PR00683	Spectrin/pleckstrin-like
IPR001605	2327	2345	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR001715	82	185	PF00307	Calponin-like actin-binding
IPR001715	201	305	PF00307	Calponin-like actin-binding
IPR002017	329	439	PF00435	Spectrin repeat
IPR002017	449	553	PF00435	Spectrin repeat
IPR002017	555	663	PF00435	Spectrin repeat
IPR002017	665	769	PF00435	Spectrin repeat
IPR002017	771	874	PF00435	Spectrin repeat
IPR002017	876	980	PF00435	Spectrin repeat
IPR002017	982	1087	PF00435	Spectrin repeat
IPR002017	1089	1194	PF00435	Spectrin repeat
IPR002017	1196	1283	PF00435	Spectrin repeat
IPR002017	1302	1405	PF00435	Spectrin repeat
IPR002017	1407	1510	PF00435	Spectrin repeat
IPR002017	1512	1610	PF00435	Spectrin repeat
IPR002017	1612	1716	PF00435	Spectrin repeat
IPR002017	1718	1823	PF00435	Spectrin repeat
IPR002017	1825	1929	PF00435	Spectrin repeat
IPR002017	1931	2035	PF00435	Spectrin repeat
IPR002017	2037	2099	PF00435	Spectrin repeat
IPR001849	2243	2352	PF00169	Pleckstrin-like
HMMSmart	IPR001715	83	183	SM00033	Calponin-like actin-binding
IPR001715	202	300	SM00033	Calponin-like actin-binding
IPR002017	332	438	SM00150	Spectrin repeat
IPR002017	452	552	SM00150	Spectrin repeat
IPR002017	558	662	SM00150	Spectrin repeat
IPR002017	668	768	SM00150	Spectrin repeat
IPR002017	774	873	SM00150	Spectrin repeat
IPR002017	879	979	SM00150	Spectrin repeat
IPR002017	985	1086	SM00150	Spectrin repeat
IPR002017	1092	1193	SM00150	Spectrin repeat
IPR002017	1199	1299	SM00150	Spectrin repeat
IPR002017	1305	1404	SM00150	Spectrin repeat
IPR002017	1410	1509	SM00150	Spectrin repeat
IPR002017	1515	1609	SM00150	Spectrin repeat
IPR002017	1615	1715	SM00150	Spectrin repeat
IPR002017	1721	1822	SM00150	Spectrin repeat
IPR002017	1828	1928	SM00150	Spectrin repeat
IPR002017	1934	2034	SM00150	Spectrin repeat
IPR002017	2040	2280	SM00150	Spectrin repeat
IPR001849	2243	2354	SM00233	Pleckstrin-like
ProfileScan	IPR001715	81	185	PS50021	Calponin-like actin-binding
IPR001715	200	302	PS50021	Calponin-like actin-binding
IPR001849	2242	2352	PS50003	Pleckstrin-like
ScanRegExp	IPR001589	83	92	PS00019	Actin-binding
IPR001589	157	181	PS00020	Actin-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGAGCAGCTGGAGATGGAGTG

Primer_r
: CCTTCTGCCTTCTGGTTCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAGCAGCTGGAGATGGAGTG
Primer_r	: CCTTCTGCCTTCTGGTTCCTC
PCR product length	: 163 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	619 bp
Genome contig ID	gi51511727r_66109299
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCACCGCCTCTGGGTGTCTTTGCTTTCCTGACCACAGCCTCTCTGCCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	66209299	66245446	37	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0302

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information