HUGE

Gene/Protein Characteristic Table for KIAA0750

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01117
Accession No. :	AB018293
Description :	Protein MICAL-2.
HUGO Gene Name :	microtubule associated monoxygenase, calponin and LIM domain containing 2 (MICAL2)
Clone Name :	hk04329 [Vector Info]
Flexi ORF Clone :	pF1KA0750
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3885 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 246 bp

Genome contig ID gi51511727f_11988734
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTAAATGGAAATAAATATTGTTCTTTATAAAGCT
Flanking genome sequence
(253179 - 253228)
----+----*----+----*----+----*----+----*----+----*
CATTGTTTCCTCTCTTCTTTGCCGTGGAAGCTTCTAAAACCTCACACACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 12088734 12241911 28 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1125 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94851	100.0	Protein MICAL-2.	Homo sapiens
XP_001096541	98.2	microtubule ass...	Macaca mulatta
XP_001097087	98.2	microtubule ass...	Macaca mulatta
XP_534061	92.3	similar to Prot...	Canis lupus fam...
XP_864179	92.3	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037785	4.6e-95	48.9	KIAA1364
AB020710	2.6e-08	29.0	KIAA0903
AB008567	3.2e-08	29.8	KIAA0302
AB051455	0.00045	29.5	KIAA1668

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001781 1003 1057 PD000094 Zinc finger

FPrintScan IPR003042 89 111 PR00420 Aromatic-ring hydroxylase

IPR003042 216 231 PR00420 Aromatic-ring hydroxylase

HMMPfam IPR002938 87 125 PF01494 Monooxygenase

IPR001715 518 623 PF00307 Calponin-like actin-binding

IPR001781 1003 1062 PF00412 Zinc finger

HMMSmart IPR001715 519 618 SM00033 Calponin-like actin-binding

IPR001781 1002 1056 SM00132 Zinc finger

ProfileScan IPR001715 517 620 PS50021 Calponin-like actin-binding

IPR001781 1001 1063 PS50023 Zinc finger

ScanRegExp IPR001781 1003 1037 PS00478 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	1003	1057	PD000094	Zinc finger
FPrintScan	IPR003042	89	111	PR00420	Aromatic-ring hydroxylase
IPR003042	216	231	PR00420	Aromatic-ring hydroxylase
HMMPfam	IPR002938	87	125	PF01494	Monooxygenase
IPR001715	518	623	PF00307	Calponin-like actin-binding
IPR001781	1003	1062	PF00412	Zinc finger
HMMSmart	IPR001715	519	618	SM00033	Calponin-like actin-binding
IPR001781	1002	1056	SM00132	Zinc finger
ProfileScan	IPR001715	517	620	PS50021	Calponin-like actin-binding
IPR001781	1001	1063	PS50023	Zinc finger
ScanRegExp	IPR001781	1003	1037	PS00478	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCACCGAAAGTTCTTGCGC

Primer_r
: TAGAGCAGAAGTGTGTCAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	246 bp
Genome contig ID	gi51511727f_11988734
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTAAATGGAAATAAATATTGTTCTTTATAAAGCT
Flanking genome sequence (253179 - 253228)	----+--------+--------+--------+--------+----* CATTGTTTCCTCTCTTCTTTGCCGTGGAAGCTTCTAAAACCTCACACACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	12088734	12241911	28	99.8	Perfect prediction

Primer_f	: TCCCACCGAAAGTTCTTGCGC
Primer_r	: TAGAGCAGAAGTGTGTCAGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0750

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information