| HUGE |
Gene/Protein Characteristic Table for KIAA0287 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00496 |
|---|---|
| Accession No. : | AB006625 |
| Description : | Zinc finger imprinted 2. |
| HUGO Gene Name : | paternally expressed 3 (PEG3) |
| Clone Name : | fg06332 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0287
|
| Source : | Human fetal brain |
| Note : | We replaced ha06162, former representative clones for KIAA0287 with fg06332. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5994 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1244 bp Genome contig ID gi42406306r_61915612 PolyA signal sequence
(None)
TATCTGACCCTCTAACTCCATGTCTAACTTGCATTFlanking genome sequence
(100000 - 99951)
AAAAAAAAAAAAATTCTTTACAGTCAACCCAAGCTTAACATGGACTCAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 62015612 62043879 9 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1523 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : Genebridge 4 | |
| : GTGCATAATACATACCCAGAG | |
| : GTTAGCAGTAGTTGTTAGGTG | |
| : 94 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
