HUGE

Gene/Protein Characteristic Table for KIAA1827

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07489
Accession No. :	AB058730
Description :	Zinc finger protein 528.
HUGO Gene Name :	zinc finger protein 528 (ZNF528)
Clone Name :	fk01409 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3072 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1662 bp

Genome contig ID gi42406306f_57510411
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCTCATGTTTGTAGTAATAAAGTTTCATTTTTCCT
Flanking genome sequence
(103055 - 103104)
----+----*----+----*----+----*----+----*----+----*
AAGTATGAATGAATCGTGTTTTCTACCGTCATAATTTCATCCCACCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 57610411 57613464 1 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q3MIS6	2.2e-203	99.8	Zinc finger pro...	Homo sapiens
XP_001116645	2e-195	95.5	similar to zinc...	Macaca mulatta
EAW72078	3.4e-173	100.0	zinc finger pro...	Homo sapiens
CAD89949	8.2e-173	99.7	hypothetical pr...	Homo sapiens
BAB15732	1.5e-127	61.8	FLJ00032 protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	5.5e-89	61.8	KIAA1611
AB107355	1.2e-80	55.3	KIAA2033
AB037770	7.5e-78	54.9	KIAA1349
D31763	2.4e-76	54.1	KIAA0065
AB075827	9.2e-75	51.4	KIAA1947

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 54 77 PD000003 Zinc finger

IPR007087 82 105 PD000003 Zinc finger

IPR007087 110 133 PD000003 Zinc finger

IPR007087 138 161 PD000003 Zinc finger

IPR007087 166 189 PD000003 Zinc finger

IPR007087 194 217 PD000003 Zinc finger

IPR007087 222 245 PD000003 Zinc finger

IPR007087 250 273 PD000003 Zinc finger

IPR007087 306 329 PD000003 Zinc finger

IPR007087 334 357 PD000003 Zinc finger

IPR007087 362 385 PD000003 Zinc finger

IPR007087 390 413 PD000003 Zinc finger

IPR007087 418 440 PD000003 Zinc finger

IPR007087 446 469 PD000003 Zinc finger

HMMPfam IPR007087 54 76 PF00096 Zinc finger

IPR007087 82 104 PF00096 Zinc finger

IPR007087 110 132 PF00096 Zinc finger

IPR007087 138 160 PF00096 Zinc finger

IPR007087 166 188 PF00096 Zinc finger

IPR007087 194 216 PF00096 Zinc finger

IPR007087 222 244 PF00096 Zinc finger

IPR007087 250 272 PF00096 Zinc finger

IPR007087 278 300 PF00096 Zinc finger

IPR007087 306 328 PF00096 Zinc finger

IPR007087 334 356 PF00096 Zinc finger

IPR007087 362 384 PF00096 Zinc finger

IPR007087 390 412 PF00096 Zinc finger

IPR007087 418 440 PF00096 Zinc finger

IPR007087 446 468 PF00096 Zinc finger

HMMSmart IPR015880 54 76 SM00355 Zinc finger

IPR015880 82 104 SM00355 Zinc finger

IPR015880 110 132 SM00355 Zinc finger

IPR015880 138 160 SM00355 Zinc finger

IPR015880 166 188 SM00355 Zinc finger

IPR015880 194 216 SM00355 Zinc finger

IPR015880 222 244 SM00355 Zinc finger

IPR015880 250 272 SM00355 Zinc finger

IPR015880 278 300 SM00355 Zinc finger

IPR015880 306 328 SM00355 Zinc finger

IPR015880 334 356 SM00355 Zinc finger

IPR015880 362 384 SM00355 Zinc finger

IPR015880 390 412 SM00355 Zinc finger

IPR015880 418 440 SM00355 Zinc finger

IPR015880 446 468 SM00355 Zinc finger

ProfileScan IPR007087 54 81 PS50157 Zinc finger

IPR007087 82 109 PS50157 Zinc finger

IPR007087 110 137 PS50157 Zinc finger

IPR007087 138 165 PS50157 Zinc finger

IPR007087 166 193 PS50157 Zinc finger

IPR007087 194 221 PS50157 Zinc finger

IPR007087 222 249 PS50157 Zinc finger

IPR007087 250 277 PS50157 Zinc finger

IPR007087 278 305 PS50157 Zinc finger

IPR007087 306 333 PS50157 Zinc finger

IPR007087 334 361 PS50157 Zinc finger

IPR007087 362 389 PS50157 Zinc finger

IPR007087 390 417 PS50157 Zinc finger

IPR007087 418 445 PS50157 Zinc finger

IPR007087 446 469 PS50157 Zinc finger

ScanRegExp IPR007087 56 76 PS00028 Zinc finger

IPR007087 84 104 PS00028 Zinc finger

IPR007087 112 132 PS00028 Zinc finger

IPR007087 140 160 PS00028 Zinc finger

IPR007087 168 188 PS00028 Zinc finger

IPR007087 196 216 PS00028 Zinc finger

IPR007087 224 244 PS00028 Zinc finger

IPR007087 252 272 PS00028 Zinc finger

IPR007087 280 300 PS00028 Zinc finger

IPR007087 308 328 PS00028 Zinc finger

IPR007087 336 356 PS00028 Zinc finger

IPR007087 364 384 PS00028 Zinc finger

IPR007087 392 412 PS00028 Zinc finger

IPR007087 420 440 PS00028 Zinc finger

IPR007087 448 468 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	54	77	PD000003	Zinc finger
IPR007087	82	105	PD000003	Zinc finger
IPR007087	110	133	PD000003	Zinc finger
IPR007087	138	161	PD000003	Zinc finger
IPR007087	166	189	PD000003	Zinc finger
IPR007087	194	217	PD000003	Zinc finger
IPR007087	222	245	PD000003	Zinc finger
IPR007087	250	273	PD000003	Zinc finger
IPR007087	306	329	PD000003	Zinc finger
IPR007087	334	357	PD000003	Zinc finger
IPR007087	362	385	PD000003	Zinc finger
IPR007087	390	413	PD000003	Zinc finger
IPR007087	418	440	PD000003	Zinc finger
IPR007087	446	469	PD000003	Zinc finger
HMMPfam	IPR007087	54	76	PF00096	Zinc finger
IPR007087	82	104	PF00096	Zinc finger
IPR007087	110	132	PF00096	Zinc finger
IPR007087	138	160	PF00096	Zinc finger
IPR007087	166	188	PF00096	Zinc finger
IPR007087	194	216	PF00096	Zinc finger
IPR007087	222	244	PF00096	Zinc finger
IPR007087	250	272	PF00096	Zinc finger
IPR007087	278	300	PF00096	Zinc finger
IPR007087	306	328	PF00096	Zinc finger
IPR007087	334	356	PF00096	Zinc finger
IPR007087	362	384	PF00096	Zinc finger
IPR007087	390	412	PF00096	Zinc finger
IPR007087	418	440	PF00096	Zinc finger
IPR007087	446	468	PF00096	Zinc finger
HMMSmart	IPR015880	54	76	SM00355	Zinc finger
IPR015880	82	104	SM00355	Zinc finger
IPR015880	110	132	SM00355	Zinc finger
IPR015880	138	160	SM00355	Zinc finger
IPR015880	166	188	SM00355	Zinc finger
IPR015880	194	216	SM00355	Zinc finger
IPR015880	222	244	SM00355	Zinc finger
IPR015880	250	272	SM00355	Zinc finger
IPR015880	278	300	SM00355	Zinc finger
IPR015880	306	328	SM00355	Zinc finger
IPR015880	334	356	SM00355	Zinc finger
IPR015880	362	384	SM00355	Zinc finger
IPR015880	390	412	SM00355	Zinc finger
IPR015880	418	440	SM00355	Zinc finger
IPR015880	446	468	SM00355	Zinc finger
ProfileScan	IPR007087	54	81	PS50157	Zinc finger
IPR007087	82	109	PS50157	Zinc finger
IPR007087	110	137	PS50157	Zinc finger
IPR007087	138	165	PS50157	Zinc finger
IPR007087	166	193	PS50157	Zinc finger
IPR007087	194	221	PS50157	Zinc finger
IPR007087	222	249	PS50157	Zinc finger
IPR007087	250	277	PS50157	Zinc finger
IPR007087	278	305	PS50157	Zinc finger
IPR007087	306	333	PS50157	Zinc finger
IPR007087	334	361	PS50157	Zinc finger
IPR007087	362	389	PS50157	Zinc finger
IPR007087	390	417	PS50157	Zinc finger
IPR007087	418	445	PS50157	Zinc finger
IPR007087	446	469	PS50157	Zinc finger
ScanRegExp	IPR007087	56	76	PS00028	Zinc finger
IPR007087	84	104	PS00028	Zinc finger
IPR007087	112	132	PS00028	Zinc finger
IPR007087	140	160	PS00028	Zinc finger
IPR007087	168	188	PS00028	Zinc finger
IPR007087	196	216	PS00028	Zinc finger
IPR007087	224	244	PS00028	Zinc finger
IPR007087	252	272	PS00028	Zinc finger
IPR007087	280	300	PS00028	Zinc finger
IPR007087	308	328	PS00028	Zinc finger
IPR007087	336	356	PS00028	Zinc finger
IPR007087	364	384	PS00028	Zinc finger
IPR007087	392	412	PS00028	Zinc finger
IPR007087	420	440	PS00028	Zinc finger
IPR007087	448	468	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGATTTAGAGAGCATGGAGG

Primer_r
: CCTATGCCTTAAGATTACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1662 bp
Genome contig ID	gi42406306f_57510411
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCTCATGTTTGTAGTAATAAAGTTTCATTTTTCCT
Flanking genome sequence (103055 - 103104)	----+--------+--------+--------+--------+----* AAGTATGAATGAATCGTGTTTTCTACCGTCATAATTTCATCCCACCTCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	57610411	57613464	1	99.0	Terminal No-hit

Primer_f	: CTGATTTAGAGAGCATGGAGG
Primer_r	: CCTATGCCTTAAGATTACAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1827

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information