| HUGE |
Gene/Protein Characteristic Table for KIAA0155 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00434 |
|---|---|
| Accession No. : | D63875 |
| Description : | RNA polymerase-associated protein CTR9 homolog. |
| HUGO Gene Name : | Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) (CTR9) |
| Clone Name : | ha02997 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0155
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4243 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 635 bp Genome contig ID gi51511727f_10629450 PolyA signal sequence
(AATAAA,-17)
CTACCTAAGCCACATAATAATAAAATTCTTTTACCFlanking genome sequence
(128415 - 128464)
AACTTTTATGGGTAACTTCGTGTCTTTTTTTGTTCGATATATTTGTGCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 10729450 10757863 25 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1195 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : Genebridge 4 | |
| : TCACTCACCTCTGGATTAGCC | |
| : TCTCCCTCCGGTAACTGATCG | |
| : 168 (1.5k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
