ROUGE |
Gene/Protein Characteristic Table for mKIAA0155 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093211 |
---|---|
SH2 domain binding protein 1 (tetratricopeptide repeat containing). TPR-containing, SH2-binding phosphoprotein. |
|
mbg02093 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4569 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2647 bp Genome contig ID gi65511124f_104802405 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CCCTCCCCAGTCACTTAATAAACCCTTTACCAACCFlanking genome sequence
(107109 - 107158) ----+----*----+----*----+----*----+----*----+----*
ATGCGAGTGCCTGTGTGTCCTCTTTTTTTTTTTCTTTTGGCTCAATAACA
KIAA Alignment based on: KIAA0155 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..333, 1272..1673, 3555..3980
Length: 386 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |