HUGE

Gene/Protein Characteristic Table for KIAA0148

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00029
Accession No. :	D63482
Description :	ARF GTPase-activating protein GIT2.
HUGO Gene Name :	G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2)
Clone Name :	fh23975 [Vector Info]
Flexi ORF Clone :	pF1KA0148
Source :	Human fetal brain
Note :	We replaced ha03431, former representative clones for KIAA0148 with fh23975. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5291 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3174 bp

Genome contig ID gi89161190r_108751992
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCTGCTAGTTATGCAATAAACAGGCTCTACAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTTTGTGGTAATGCTGTGCTCCCCATCAATTAGTTGATGTTTCCAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 108851992 108918483 18 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 704 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11141	100.0	ARF GTPase-acti...	synthetic construct
NP_055591	99.6	G protein-coupl...	Homo sapiens
XP_863901	96.0	similar to G pr...	Canis lupus fam...
XP_863985	95.7	similar to G pr...	Canis lupus fam...
NP_001070827	91.9	G protein-coupl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	2.2e-08	32.7	KIAA1099
D79989	8.6e-08	33.3	KIAA0167
AB075855	2.1e-07	34.1	KIAA1975
AB051503	1e-06	38.7	KIAA1716
D26069	2.6e-06	40.9	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 31 50 PR00405 Arf GTPase activating protein

IPR001164 50 67 PR00405 Arf GTPase activating protein

IPR001164 71 92 PR00405 Arf GTPase activating protein

HMMPfam IPR001164 22 147 PF01412 Arf GTPase activating protein

IPR002110 160 183 PF00023 Ankyrin

IPR002110 189 221 PF00023 Ankyrin

IPR002110 222 244 PF00023 Ankyrin

IPR013724 291 321 PF08518 Spa2 homology (SHD) of GIT

IPR013724 355 385 PF08518 Spa2 homology (SHD) of GIT

HMMSmart IPR001164 22 147 SM00105 Arf GTPase activating protein

IPR002110 155 184 SM00248 Ankyrin

IPR002110 189 218 SM00248 Ankyrin

IPR002110 222 251 SM00248 Ankyrin

IPR013724 291 321 SM00555 Spa2 homology (SHD) of GIT

IPR013724 355 385 SM00555 Spa2 homology (SHD) of GIT

ProfileScan IPR001164 22 147 PS50115 Arf GTPase activating protein

IPR002110 155 244 PS50297 Ankyrin

IPR002110 189 221 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	31	50	PR00405	Arf GTPase activating protein
IPR001164	50	67	PR00405	Arf GTPase activating protein
IPR001164	71	92	PR00405	Arf GTPase activating protein
HMMPfam	IPR001164	22	147	PF01412	Arf GTPase activating protein
IPR002110	160	183	PF00023	Ankyrin
IPR002110	189	221	PF00023	Ankyrin
IPR002110	222	244	PF00023	Ankyrin
IPR013724	291	321	PF08518	Spa2 homology (SHD) of GIT
IPR013724	355	385	PF08518	Spa2 homology (SHD) of GIT
HMMSmart	IPR001164	22	147	SM00105	Arf GTPase activating protein
IPR002110	155	184	SM00248	Ankyrin
IPR002110	189	218	SM00248	Ankyrin
IPR002110	222	251	SM00248	Ankyrin
IPR013724	291	321	SM00555	Spa2 homology (SHD) of GIT
IPR013724	355	385	SM00555	Spa2 homology (SHD) of GIT
ProfileScan	IPR001164	22	147	PS50115	Arf GTPase activating protein
IPR002110	155	244	PS50297	Ankyrin
IPR002110	189	221	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GCATCAGTAAATAGGGGAACG
Primer_r	: CCACTCATAATAGACGCAGGG
PCR product length	: 203 (3.0k) bp
PCR conditions	: 95 °C15 sec64 °C180 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3174 bp
Genome contig ID	gi89161190r_108751992
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCTGCTAGTTATGCAATAAACAGGCTCTACAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTTGTGGTAATGCTGTGCTCCCCATCAATTAGTTGATGTTTCCAGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	108851992	108918483	18	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0148

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information