HUGE

Gene/Protein Characteristic Table for KIAA1716

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00897
Accession No. :	AB051503
Description :	Centaurin-beta 5.
HUGO Gene Name :	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (ACAP3)
Clone Name :	hj06603 [Vector Info]
Flexi ORF Clone :	pF1KSDA1716
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5319 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1174 bp

Genome contig ID gi89161185r_1117633
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCACCCCTCGCTTTGAATAAAGCACTTGCGCCCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCCTGCTCCTGGGCTCCCGTGCCTTGCTCTGCTCTGTCTCCGGGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 1217633 1231172 21 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 804 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL04165	100.0	centaurin beta5...	Homo sapiens
Q96P50	95.6	ArfGAP with coi...	Homo sapiens
AAH51194	95.5	CENTB5 protein ...	Homo sapiens
EAW56250	95.1	centaurin, beta...	Homo sapiens
XP_001093292	94.0	similar to cent...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	4.4e-102	60.5	KIAA0041
D30758	7.4e-75	49.6	KIAA0050
AB075855	4.6e-15	41.0	KIAA1975
AB029022	8.4e-15	39.8	KIAA1099
D79989	1.4e-14	39.4	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 418 437 PR00405 Arf GTPase activating protein

IPR001164 437 454 PR00405 Arf GTPase activating protein

IPR001164 458 479 PR00405 Arf GTPase activating protein

IPR002110 706 718 PR01415 Ankyrin

IPR002110 718 730 PR01415 Ankyrin

HMMPfam IPR001849 272 366 PF00169 Pleckstrin-like

IPR001164 406 528 PF01412 Arf GTPase activating protein

IPR002110 643 669 PF00023 Ankyrin

IPR002110 672 704 PF00023 Ankyrin

IPR002110 705 737 PF00023 Ankyrin

IPR002110 738 758 PF00023 Ankyrin

HMMSmart IPR001849 272 368 SM00233 Pleckstrin-like

IPR001164 406 528 SM00105 Arf GTPase activating protein

IPR002110 672 701 SM00248 Ankyrin

IPR002110 705 734 SM00248 Ankyrin

ProfileScan IPR001849 271 366 PS50003 Pleckstrin-like

IPR001164 406 528 PS50115 Arf GTPase activating protein

IPR002110 643 758 PS50297 Ankyrin

IPR002110 672 704 PS50088 Ankyrin

IPR002110 705 737 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	418	437	PR00405	Arf GTPase activating protein
IPR001164	437	454	PR00405	Arf GTPase activating protein
IPR001164	458	479	PR00405	Arf GTPase activating protein
IPR002110	706	718	PR01415	Ankyrin
IPR002110	718	730	PR01415	Ankyrin
HMMPfam	IPR001849	272	366	PF00169	Pleckstrin-like
IPR001164	406	528	PF01412	Arf GTPase activating protein
IPR002110	643	669	PF00023	Ankyrin
IPR002110	672	704	PF00023	Ankyrin
IPR002110	705	737	PF00023	Ankyrin
IPR002110	738	758	PF00023	Ankyrin
HMMSmart	IPR001849	272	368	SM00233	Pleckstrin-like
IPR001164	406	528	SM00105	Arf GTPase activating protein
IPR002110	672	701	SM00248	Ankyrin
IPR002110	705	734	SM00248	Ankyrin
ProfileScan	IPR001849	271	366	PS50003	Pleckstrin-like
IPR001164	406	528	PS50115	Arf GTPase activating protein
IPR002110	643	758	PS50297	Ankyrin
IPR002110	672	704	PS50088	Ankyrin
IPR002110	705	737	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTATGTGCTCCAGATCAATG

Primer_r
: CTGCCAGCTTCTTCATGTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1174 bp
Genome contig ID	gi89161185r_1117633
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCACCCCTCGCTTTGAATAAAGCACTTGCGCCCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCCTGCTCCTGGGCTCCCGTGCCTTGCTCTGCTCTGTCTCCGGGGAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	1217633	1231172	21	99.5	Perfect prediction

Primer_f	: ACTATGTGCTCCAGATCAATG
Primer_r	: CTGCCAGCTTCTTCATGTAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1716

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information