HUGE |
Gene/Protein Characteristic Table for KIAA0121 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00022 |
---|---|
Accession No. : | D50911 |
Description : | Transcription cofactor vestigial-like protein 4. |
HUGO Gene Name : | vestigial like 4 (Drosophila) (VGLL4) |
Clone Name : | fk13569 [Vector Info] |
Flexi ORF Clone : | pF1KA0121
![]() |
Source : | Human fetal brain |
Note : | We replaced ha01159, former representative clones for KIAA0121 with fk13569. (2001/10/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3495 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2486 bp Genome contig ID gi89161205r_11472544 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TAGCCTTAAGAACAATAATAAAGTGCTCTTAAACCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACATAGTGTACGTGTGCAGTTTCAGCGCCAGGCTGGGTGGGCGGACTCGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 11572544 11736990 5 99.1 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 312 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Stanford G3 | |
: TAACAGGAAAACCACCCACAG | |
: TCACGGAGCCCCTTCTTAGAG | |
: 243 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |