HUGE

Gene/Protein Characteristic Table for KIAA0121

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00022
Accession No. :	D50911
Description :	Transcription cofactor vestigial-like protein 4.
HUGO Gene Name :	vestigial like 4 (Drosophila) (VGLL4)
Clone Name :	fk13569 [Vector Info]
Flexi ORF Clone :	pF1KA0121
Source :	Human fetal brain
Note :	We replaced ha01159, former representative clones for KIAA0121 with fk13569. (2001/10/06)

Features of the cloned DNA sequence	Description

Length: 3495 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2486 bp

Genome contig ID gi89161205r_11472544
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAGCCTTAAGAACAATAATAAAGTGCTCTTAAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATAGTGTACGTGTGCAGTTTCAGCGCCAGGCTGGGTGGGCGGACTCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 11572544 11736990 5 99.1 Internal No-hit

Features of the protein sequence	Description

Length: 312 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001087506	5.9e-109	98.6	similar to vest...	Macaca mulatta
Q14135	3e-108	100.0	Transcription c...	Homo sapiens
EAW64104	6e-108	99.7	vestigial like ...	Homo sapiens
CAH90159	1.8e-107	99.0	hypothetical pr...	Pongo abelii
XP_001492857	6.6e-101	92.8	similar to vest...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 45 293 PD110857 NULL

HMMSmart IPR006627 228 243 SM00711 Protein of unknown function TDU

IPR006627 256 271 SM00711 Protein of unknown function TDU

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	45	293	PD110857	NULL
HMMSmart	IPR006627	228	243	SM00711	Protein of unknown function TDU
IPR006627	256	271	SM00711	Protein of unknown function TDU

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TAACAGGAAAACCACCCACAG
Primer_r	: TCACGGAGCCCCTTCTTAGAG
PCR product length	: 243 bp
PCR conditions	: 95 °C15 sec66 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2486 bp
Genome contig ID	gi89161205r_11472544
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGCCTTAAGAACAATAATAAAGTGCTCTTAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATAGTGTACGTGTGCAGTTTCAGCGCCAGGCTGGGTGGGCGGACTCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	11572544	11736990	5	99.1	Internal No-hit

Gene/Protein Characteristic Table for KIAA0121

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information