ROUGE

Gene/Protein Characteristic Table for mKIAA0121

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC060305
Description :	vestigial like 4.
Clone Name :	mtk02531 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 1329 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 76 bp

Genome contig ID gi65504368r_115197489
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGCCTGAGCTTTGAACAGTCAGTGCTTAAAAAAAC
Flanking genome sequence
(99992 - 99943)
----+----*----+----*----+----*----+----*----+----*
AGAAAGAAAAAAAAAATCCTGGGGGGAGGGTGGGTGGGTGGTTTATTCGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0121 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0121	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 390..1253
Length: 287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80V24	4.7e-113	100.0	Transcription c...	Mus musculus
AAH91399	4.7e-112	99.3	Vestigial like ...	Rattus norvegicus
BAE37393	4.9e-101	100.0	unnamed protein...	Mus musculus
EDM02164	4.9e-100	99.2	vestigial like ...	Rattus norvegicus
AAI46173	7.9e-84	85.5	VGLL4 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	76 bp
Genome contig ID	gi65504368r_115197489
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCCTGAGCTTTGAACAGTCAGTGCTTAAAAAAAC
Flanking genome sequence (99992 - 99943)	----+--------+--------+--------+--------+----* AGAAAGAAAAAAAAAATCCTGGGGGGAGGGTGGGTGGGTGGTTTATTCGC

Gene/Protein Characteristic Table for mKIAA0121

Features of the cloned DNA sequence

Features of the protein sequence