HUGE

Gene/Protein Characteristic Table for KIAA1249

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04720
Accession No. :	AB033075
Description :	130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase- activating protein.
HUGO Gene Name :	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 (ASAP1)
Clone Name :	hh04184 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5475 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2624 bp

Genome contig ID gi51511724r_131033535
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ATTGCTTTTAAATAAACATATTCTCAGTTGATCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTCTGAAATCAGGCCATTTTGTGAGTTGTTCACTACCCTGCTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 131133535 131262290 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 949 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001155932	99.9	development and...	Pan troglodytes
CAD97831	99.7	hypothetical pr...	Homo sapiens
EAW92131	99.7	development and...	Homo sapiens
EAW92130	99.7	development and...	Homo sapiens
XP_519959	99.6	development and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007860	1.2e-52	53.0	KIAA0400
AB075855	2e-05	31.4	KIAA1975
D26069	2.8e-05	30.1	KIAA0041
AB029022	2.8e-05	31.1	KIAA1099
D79989	0.00013	29.7	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 892 944 PD000066 Src homology-3

FPrintScan IPR001164 271 290 PR00405 Arf GTPase activating protein

IPR001164 290 307 PR00405 Arf GTPase activating protein

IPR001164 311 332 PR00405 Arf GTPase activating protein

IPR000108 791 808 PR00499 Neutrophil cytosol factor 2

IPR001452 890 900 PR00452 Src homology-3

IPR000108 892 912 PR00499 Neutrophil cytosol factor 2

IPR001452 904 919 PR00452 Src homology-3

IPR000108 912 928 PR00499 Neutrophil cytosol factor 2

IPR001452 921 930 PR00452 Src homology-3

IPR001452 935 947 PR00452 Src homology-3

HMMPfam IPR001849 145 236 PF00169 Pleckstrin-like

IPR001164 259 382 PF01412 Arf GTPase activating protein

IPR002110 420 455 PF00023 Ankyrin

IPR002110 456 488 PF00023 Ankyrin

IPR001452 890 947 PF00018 Src homology-3

HMMSmart IPR001849 145 238 SM00233 Pleckstrin-like

IPR001164 259 382 SM00105 Arf GTPase activating protein

IPR002110 420 452 SM00248 Ankyrin

IPR002110 456 485 SM00248 Ankyrin

IPR001452 890 948 SM00326 Src homology-3

ProfileScan IPR001849 144 236 PS50003 Pleckstrin-like

IPR001164 259 372 PS50115 Arf GTPase activating protein

IPR002110 420 455 PS50088 Ankyrin

IPR002110 420 497 PS50297 Ankyrin

IPR001452 887 949 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	892	944	PD000066	Src homology-3
FPrintScan	IPR001164	271	290	PR00405	Arf GTPase activating protein
IPR001164	290	307	PR00405	Arf GTPase activating protein
IPR001164	311	332	PR00405	Arf GTPase activating protein
IPR000108	791	808	PR00499	Neutrophil cytosol factor 2
IPR001452	890	900	PR00452	Src homology-3
IPR000108	892	912	PR00499	Neutrophil cytosol factor 2
IPR001452	904	919	PR00452	Src homology-3
IPR000108	912	928	PR00499	Neutrophil cytosol factor 2
IPR001452	921	930	PR00452	Src homology-3
IPR001452	935	947	PR00452	Src homology-3
HMMPfam	IPR001849	145	236	PF00169	Pleckstrin-like
IPR001164	259	382	PF01412	Arf GTPase activating protein
IPR002110	420	455	PF00023	Ankyrin
IPR002110	456	488	PF00023	Ankyrin
IPR001452	890	947	PF00018	Src homology-3
HMMSmart	IPR001849	145	238	SM00233	Pleckstrin-like
IPR001164	259	382	SM00105	Arf GTPase activating protein
IPR002110	420	452	SM00248	Ankyrin
IPR002110	456	485	SM00248	Ankyrin
IPR001452	890	948	SM00326	Src homology-3
ProfileScan	IPR001849	144	236	PS50003	Pleckstrin-like
IPR001164	259	372	PS50115	Arf GTPase activating protein
IPR002110	420	455	PS50088	Ankyrin
IPR002110	420	497	PS50297	Ankyrin
IPR001452	887	949	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGAGTGAAGACCATTTATGAC

Primer_r
: TTGCTAGTCAGACAGGATATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCAAACAGAGCATGAGGAACC
Primer_r	: GTGTAAATGAATGACCGGGAC
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2624 bp
Genome contig ID	gi51511724r_131033535
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATTGCTTTTAAATAAACATATTCTCAGTTGATCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTCTGAAATCAGGCCATTTTGTGAGTTGTTCACTACCCTGCTGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	131133535	131262290	23	99.9	Perfect prediction

Primer_f	: CGAGTGAAGACCATTTATGAC
Primer_r	: TTGCTAGTCAGACAGGATATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1249

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information