HUGE

Gene/Protein Characteristic Table for KIAA0029

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00005
Accession No. :	D21852
Description :	R3H domain-containing protein 1.
HUGO Gene Name :	R3H domain containing 1 (R3HDM1)
Clone Name :	ha00566 [Vector Info]
Flexi ORF Clone :	pF1KA0029
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4272 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 974 bp

Genome contig ID gi89161199f_135905541
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CCTTTTTCAGTTCAAGAGAATAAATGTTTACAAAT
Flanking genome sequence
(293767 - 293816)
----+----*----+----*----+----*----+----*----+----*
ATAGGCTCACTTTGTCTTTTTTTTAATTAAAAACACCTTTTAAATGAGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 136005541 136199306 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 974 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11123	100.0	R3H domain-cont...	synthetic construct
EAX11627	99.9	R3H domain cont...	Homo sapiens
XP_001154157	99.5	R3H domain (bin...	Pan troglodytes
XP_856389	95.6	similar to R3H ...	Canis lupus fam...
XP_001153781	99.5	R3H domain (bin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023219	4e-16	49.8	KIAA1002

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001374 134 187 PF01424 Single-stranded nucleic acid binding R3H

HMMSmart IPR001374 110 187 SM00393 Single-stranded nucleic acid binding R3H

ProfileScan IPR001374 127 190 PS51061 Single-stranded nucleic acid binding R3H

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001374	134	187	PF01424	Single-stranded nucleic acid binding R3H
HMMSmart	IPR001374	110	187	SM00393	Single-stranded nucleic acid binding R3H
ProfileScan	IPR001374	127	190	PS51061	Single-stranded nucleic acid binding R3H

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GCCACATTCCCCTCCATTTC
Primer_r	: AGGGCAGGGGAACCATAAAG
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	974 bp
Genome contig ID	gi89161199f_135905541
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCTTTTTCAGTTCAAGAGAATAAATGTTTACAAAT
Flanking genome sequence (293767 - 293816)	----+--------+--------+--------+--------+----* ATAGGCTCACTTTGTCTTTTTTTTAATTAAAAACACCTTTTAAATGAGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	136005541	136199306	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0029

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information