| HUGE |
Gene/Protein Characteristic Table for KIAA0019 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00366 |
|---|---|
| Accession No. : | D13644 |
| Description : | USP6 N-terminal-like protein. |
| HUGO Gene Name : | USP6 N-terminal like (USP6NL) |
| Clone Name : | ha00537 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0019
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4602 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1836 bp Genome contig ID gi89161187r_11442661 PolyA signal sequence
(AATATA,-21)
ATATATATGCAAAAAATATATATATACACACAAGCFlanking genome sequence
(99942 - 99893)
ACTATTTTCTTATGTCATTTATGACATTTTTTATCTGTATACTTTTTTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 11542603 11693643 15 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 838 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : Genebridge 4 | |
| : TCACATCCACATACTAAGAG | |
| : GCAGAAGAAAGAAGTAACCA | |
| : 176 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
