HUGE

Gene/Protein Characteristic Table for KIAA0608

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00574
Accession No. :	AB011180
Description :	TBC1 domain family member 12.
HUGO Gene Name :	TBC1 domain family, member 12 (TBC1D12)
Clone Name :	hh00889b [Vector Info]
Flexi ORF Clone :	pF1KSDA0608
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3344 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1015 bp

Genome contig ID gi89161187f_96052342
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGCATAATTTTTCCTAATCAGTGGAAATAAGAAT
Flanking genome sequence
(231518 - 231567)
----+----*----+----*----+----*----+----*----+----*
AAAAGAAAAAGGTAAAGTTAATTTTTTTTCTAAGTCTACATCCTATCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 96152342 96283858 14 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 775 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_507936	0	100.0	TBC1 domain fam...	Pan troglodytes
BAG09776	0	100.0	TBC1 domain fam...	synthetic construct
O60347	0	99.2	TBC1 domain fam...	Homo sapiens
XP_849591	0	86.3	similar to TBC1...	Canis lupus fam...
XP_001090278	1.3e-213	87.6	TBC1 domain fam...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037743	1.1e-77	70.6	KIAA1322
D13644	2.5e-08	28.1	KIAA0019
AB029031	2.1e-07	21.7	KIAA1108
AB011175	1.1e-06	22.3	KIAA0603
AB028978	9.6e-05	24.4	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 483 714 PF00566 RabGAP/TBC

HMMSmart IPR000195 481 715 SM00164 RabGAP/TBC

ProfileScan IPR000195 484 692 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	483	714	PF00566	RabGAP/TBC
HMMSmart	IPR000195	481	715	SM00164	RabGAP/TBC
ProfileScan	IPR000195	484	692	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GACATTGTTTCCAGTTCTGAC

Primer_r
: CTAGGTAACTCGAATTTGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GACATTGTTTCCAGTTCTGAC
Primer_r	: CTAGGTAACTCGAATTTGCCC
PCR product length	: 222 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1015 bp
Genome contig ID	gi89161187f_96052342
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGCATAATTTTTCCTAATCAGTGGAAATAAGAAT
Flanking genome sequence (231518 - 231567)	----+--------+--------+--------+--------+----* AAAAGAAAAAGGTAAAGTTAATTTTTTTTCTAAGTCTACATCCTATCTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	96152342	96283858	14	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0608

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information