| HUGE |
Gene/Protein Characteristic Table for KIAA0676 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07069 |
|---|---|
| Accession No. : | AB014576 |
| Description : | TBC1 domain family member 9B. |
| HUGO Gene Name : | TBC1 domain family, member 9B (with GRAM domain) (TBC1D9B) |
| Clone Name : | hk02596 [Vector Info] |
| Flexi ORF Clone : | pF1KA0676
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4491 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1262 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AGAGACAGTTCAGCACCGCCA | |
| : CACTGATGACACCTTGGGCCA | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : GeneBridge 4 | |
| : AGAGACAGTTCAGCACCGCCA | |
| : CACTGATGACACCTTGGGCCA | |
| : 93 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
