KIAA1876

Product ID	ORK04860
Accession No	AB058779
Description	euchromatic histone-lysine N-methyltransferase 1
Clone name	pf01162s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1358) was subcloned upstream of the cDNA (1359-7842). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGCCGCGGGA ATTCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (7842 bp) Predicted protein sequence (803 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1876 by Kazusa Mouse cDNA Project
Note	We replaced pf01162, former representative clones for KIAA1876 with pf01162s1. (2002/5/10)

Length: 7842 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	5430 bp
Genome contig ID	gi89161216f_139666602
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTTCAGCCTGGGCAACAGATCGAGATTTCGTCT
Flanking genome sequence (217689 - 217738)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAACATAACAGGCCGAGTGTGGTGGCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	139758337	139884289	22	99.3	Perfect prediction

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB56104	100.0	GLP1 [Homo sapi...	Homo sapiens
Q9H9B1	100.0	Histone-lysine ...	Homo sapiens
AAM09024	99.9	euchromatic his...	Homo sapiens
XP_520395	99.8	euchromatic his...	Pan troglodytes
XP_848228	92.0	similar to euch...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023174	9.1e-14	30.1	KIAA0957
AB033049	4.4e-13	35.1	KIAA1223
AB033076	1.8e-09	31.5	KIAA1250
AB002377	2.5e-09	33.1	KIAA0379
AB014597	1.2e-07	28.7	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	458	470	PR01415	Ankyrin
FPrintScan	IPR002110	504	516	PR01415	Ankyrin
HMMPfam	IPR002110	391	423	PF00023	Ankyrin
	IPR002110	424	456	PF00023	Ankyrin
	IPR002110	457	490	PF00023	Ankyrin
	IPR002110	491	523	PF00023	Ankyrin
	IPR002110	524	556	PF00023	Ankyrin
	IPR002110	557	589	PF00023	Ankyrin
	IPR002110	590	601	PF00023	Ankyrin
	IPR007728	632	737	PF05033	Pre-SET zinc-binding region
	IPR001214	739	798	PF00856	SET
HMMSmart	IPR002110	391	420	SM00248	Ankyrin
	IPR002110	424	455	SM00248	Ankyrin
	IPR002110	457	487	SM00248	Ankyrin
	IPR002110	491	520	SM00248	Ankyrin
	IPR002110	524	553	SM00248	Ankyrin
	IPR002110	557	586	SM00248	Ankyrin
	IPR002110	590	623	SM00248	Ankyrin
	IPR003606	630	729	SM00468	Pre-SET zinc-binding sub-group
ProfileScan	IPR002110	361	598	PS50297	Ankyrin
	IPR002110	391	423	PS50088	Ankyrin
	IPR002110	424	456	PS50088	Ankyrin
	IPR002110	457	481	PS50088	Ankyrin
	IPR002110	491	523	PS50088	Ankyrin
	IPR002110	557	589	PS50088	Ankyrin
	IPR007728	679	742	PS50867	Pre-SET zinc-binding region
	IPR001214	744	803	PS50280	SET

Primer_f	TGAGACAGGTGATTCCGTAAC
Primer_r	GGGTCAGCTCTGCAAAGGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TGAGACAGGTGATTCCGTAAC
Primer_r	GGGTCAGCTCTGCAAAGGTAG
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec175 cycles