KIAA0957

Product ID	ORK00696
Accession No	AB023174
Description	ankyrin repeat domain 6, transcript variant 4
Clone name	hj05670
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5080 bp) Predicted protein sequence (693 aa)
HaloTag ORF Clone	FHC00696
Flexi ORF Clone	FXC00696
Source	Human adult brain
Rouge ID	mKIAA0957 by Kazusa Mouse cDNA Project

Length: 5080 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2833 bp
Genome contig ID	gi89161210f_90233270
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- CTTAAATTCCTTATTAAAAAAATGCAAGTGTGAAT
Flanking genome sequence (167006 - 167055)	----+--------+--------+--------+--------+----* ACTTTGTTTAGCTTACATTTTAATTTATTGTGGTTGACCACATTTTATGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	90333270	90400274	14	99.3	Terminal No-hit

Length: 693 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48551	100.0	ankyrin repeat ...	Homo sapiens
CAI39609	99.9	ankyrin repeat ...	Homo sapiens
XP_001158956	99.7	ankyrin repeat ...	Pan troglodytes
XP_001097332	98.3	ankyrin repeat ...	Macaca mulatta
EAW48550	98.3	ankyrin repeat ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058779	1.3e-13	30.1	KIAA1876
AB033076	3.3e-13	30.2	KIAA1250
AB033049	4.5e-12	33.3	KIAA1223
AB014597	1.4e-10	27.4	KIAA0697
AB037755	1.9e-10	22.6	KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	43	55	PR01415	Ankyrin
FPrintScan	IPR002110	220	232	PR01415	Ankyrin
HMMPfam	IPR002110	15	37	PF00023	Ankyrin
	IPR002110	42	74	PF00023	Ankyrin
	IPR002110	75	107	PF00023	Ankyrin
	IPR002110	108	140	PF00023	Ankyrin
	IPR002110	141	173	PF00023	Ankyrin
	IPR002110	174	206	PF00023	Ankyrin
	IPR002110	207	239	PF00023	Ankyrin
	IPR002110	240	273	PF00023	Ankyrin
HMMSmart	IPR002110	10	39	SM00248	Ankyrin
	IPR002110	42	71	SM00248	Ankyrin
	IPR002110	75	104	SM00248	Ankyrin
	IPR002110	108	137	SM00248	Ankyrin
	IPR002110	141	170	SM00248	Ankyrin
	IPR002110	174	203	SM00248	Ankyrin
	IPR002110	207	236	SM00248	Ankyrin
	IPR002110	240	270	SM00248	Ankyrin
ProfileScan	IPR002110	42	74	PS50088	Ankyrin
	IPR002110	42	260	PS50297	Ankyrin
	IPR002110	75	107	PS50088	Ankyrin
	IPR002110	108	140	PS50088	Ankyrin
	IPR002110	141	173	PS50088	Ankyrin
	IPR002110	174	206	PS50088	Ankyrin
	IPR002110	207	239	PS50088	Ankyrin

Primer_f	GGTCATGTTTCAAATCAAGGC
Primer_r	CTCCACAAACAAGGCATAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-