Order Kazusa clone(s) from : ![]() |
Product ID | ORK00711 |
---|---|
Accession No | AB023214 |
Description | zinc finger and BTB domain containing 1, transcript variant 2 |
Clone name | hk08613 |
Vector information | |
cDNA sequence | DNA sequence (3990 bp) Predicted protein sequence (646 aa) |
Flexi ORF Clone | FXC00711 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1793 bp |
---|---|
Genome contig ID | gi51511730f_63941174 |
PolyA signal sequence (AATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (128989 - 129038) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 64041174 | 64070161 | 3 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 16 | 122 | PF00651 | BTB/POZ |
IPR007087 | 536 | 558 | PF00096 | Zinc finger | |
IPR007087 | 608 | 630 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 26 | 123 | SM00225 | BTB/POZ-like |
IPR015880 | 218 | 244 | SM00355 | Zinc finger | |
IPR015880 | 423 | 445 | SM00355 | Zinc finger | |
IPR015880 | 536 | 556 | SM00355 | Zinc finger | |
IPR015880 | 580 | 602 | SM00355 | Zinc finger | |
IPR015880 | 608 | 630 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 26 | 93 | PS50097 | BTB/POZ-like |
IPR007087 | 580 | 607 | PS50157 | Zinc finger | |
IPR007087 | 608 | 635 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 582 | 602 | PS00028 | Zinc finger |
IPR007087 | 610 | 630 | PS00028 | Zinc finger |
![]() |
Primer_f | GTCCTTCAGCAGCTAAACAAC |
---|---|
Primer_r | TAGAACTGCCTTGTGTGCTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | GTCCTTCAGCAGCTAAACAAC |
Primer_r | TAGAACTGCCTTGTGTGCTTG |
PCR product length | 99 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |