Order Kazusa clone(s) from : ![]() |
Product ID | ORK00058 |
---|---|
Accession No | AB002352 |
Description | zinc finger and BTB domain containing 5 |
Clone name | hg01842 |
Vector information | |
cDNA sequence | DNA sequence (4631 bp) Predicted protein sequence (730 aa) |
Flexi ORF Clone | FXC00058 |
Source | Human adult brain |
Rouge ID |
mKIAA0354
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 67 | 176 | PF00651 | BTB/POZ |
IPR007087 | 694 | 717 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 77 | 176 | SM00225 | BTB/POZ-like |
IPR015880 | 666 | 688 | SM00355 | Zinc finger | |
IPR015880 | 694 | 714 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 77 | 146 | PS50097 | BTB/POZ-like |
IPR007087 | 666 | 693 | PS50157 | Zinc finger | |
IPR007087 | 694 | 726 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 668 | 688 | PS00028 | Zinc finger |
![]() |
---|
Primer_f | AAGTTGTAACCAGCATAGCAC |
---|---|
Primer_r | TTATAGTCTGGCGTGATCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGTTGTAACCAGCATAGCAC |
Primer_r | TTATAGTCTGGCGTGATCATG |
PCR product length | 112 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |