KIAA0865

Product ID	ORK01612
Accession No	AB020672
Description	myosin XVI, transcript variant 2
Clone name	hk06640y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6864 bp) Predicted protein sequence (1900 aa)
HaloTag ORF Clone	FHC01612
Flexi ORF Clone	FXC01612
Source	Human adult brain
Rouge ID	mKIAA0865 by Kazusa Mouse cDNA Project
Note	We replaced hk06640, former representative clones for KIAA0865 with hk06640y1. (2003/4/2)

Length: 6864 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1161 bp
Genome contig ID	gi51511729f_107946501
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAAAGTTACTGTGCCAATAAAGAGGTACAACTGTG
Flanking genome sequence (711847 - 711896)	----+--------+--------+--------+--------+----* TTCTTCTATTGTTTTTGTTGTTGTTATTATTGTCTCCCATGAACTCTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	108046501	108658346	35	99.6	Perfect prediction

Length: 1900 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509728	99.2	myosin heavy ch...	Pan troglodytes
AAI46792	100.0	Myosin XVI [Hom...	Homo sapiens
Q9Y6X6	99.9	Myosin-XVI; Unc...	Homo sapiens
XP_001085293	95.2	similar to myos...	Macaca mulatta
XP_542665	70.4	similar to myos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040919	5.2e-16	43.1	KIAA1486
AB018270	2.6e-15	30.5	KIAA0727
AB020630	1.1e-06	29.2	KIAA0823
AB002387	2.1e-05	28.9	KIAA0389
D86970	0.0001	24.6	KIAA0216

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	297	309	PR01415	Ankyrin
	IPR002110	309	321	PR01415	Ankyrin
	IPR001609	473	492	PR00193	Myosin head
	IPR001609	532	557	PR00193	Myosin head
	IPR001609	576	603	PR00193	Myosin head
	IPR001609	815	843	PR00193	Myosin head
HMMPfam	IPR002110	134	166	PF00023	Ankyrin
	IPR002110	167	199	PF00023	Ankyrin
	IPR002110	200	234	PF00023	Ankyrin
	IPR002110	247	262	PF00023	Ankyrin
	IPR002110	263	295	PF00023	Ankyrin
	IPR002110	296	328	PF00023	Ankyrin
	IPR001609	445	866	PF00063	Myosin head
	IPR001609	886	1175	PF00063	Myosin head
	IPR000048	1190	1210	PF00612	IQ calmodulin-binding region
HMMSmart	IPR002110	134	163	SM00248	Ankyrin
	IPR002110	167	196	SM00248	Ankyrin
	IPR002110	200	231	SM00248	Ankyrin
	IPR002110	263	292	SM00248	Ankyrin
	IPR002110	296	325	SM00248	Ankyrin
	IPR001609	440	1188	SM00242	Myosin head
ProfileScan	IPR002110	101	328	PS50297	Ankyrin
	IPR002110	134	166	PS50088	Ankyrin
	IPR002110	167	199	PS50088	Ankyrin
	IPR002110	263	295	PS50088	Ankyrin
	IPR002110	296	328	PS50088	Ankyrin
	IPR000048	1189	1218	PS50096	IQ calmodulin-binding region

Primer_f	CGGTTAAACACGTATGGCTTC
Primer_r	TCCAAGTAGCAAGACAAGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTCGCTGTATATCCTCAACC
Primer_r	TCCAAGTAGCAAGACAAGGTG
PCR product length	117 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles