KIAA1075

Product ID	ORK00732
Accession No	AB028998
Description	tensin 2, transcript variant 2
Clone name	hj06716s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5009 bp) Predicted protein sequence (1505 aa)
HaloTag ORF Clone	FHC00732
Flexi ORF Clone	FXC00732
Source	Human adult brain
Rouge ID	mKIAA1075 by Kazusa Mouse cDNA Project
Note	We replaced hj06716, former representative clones for KIAA1075 with hj06716s1. (2002/5/10)

Length: 5009 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	489 bp
Genome contig ID	gi89161190f_51629947
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTTGTCTAATAATAAAGAATTTCTATAAACTTT
Flanking genome sequence (114477 - 114526)	----+--------+--------+--------+--------+----* AGCCGAAATTGGAGTCAACACTTATTCACAGGAAGGTCAAAGCCTCATCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	51729947	51744422	29	100.0	Perfect prediction

Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509087	99.5	tensin like C1 ...	Pan troglodytes
AAM74225	100.0	C1 domain-conta...	Homo sapiens
Q63HR2	99.9	Tensin-like C1 ...	Homo sapiens
AAN03866	99.2	C1 domain-conta...	Homo sapiens
NP_056134	99.1	tensin like C1 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007942	3.7e-05	25.2	KIAA0473

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	1236	1340	PD000093	SH2 motif
HMMPfam	IPR002219	128	178	PF00130	Protein kinase C
	IPR000980	1236	1328	PF00017	SH2 motif
	IPR013625	1371	1504	PF08416	Tensin phosphotyrosine-binding domain
HMMSmart	IPR002219	128	175	SM00109	Protein kinase C
	IPR000980	1234	1334	SM00252	SH2 motif
	IPR006020	1367	1505	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR002219	127	175	PS50081	Protein kinase C
	IPR014019	218	390	PS51181	Phosphatase tensin type
	IPR014020	395	521	PS51182	C2 tensin-type
	IPR000980	1236	1347	PS50001	SH2 motif
ScanRegExp	IPR002219	128	175	PS00479	Protein kinase C

Primer_f	TCCTACTCTGAATCTCTGCTC
Primer_r	AGTTGAGCCCCGAAGGAGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGTTGAGCCCCGAAGGAGATC
Primer_r	TCCTACTCTGAATCTCTGCTC
PCR product length	167 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles