Order Kazusa clone(s) from : ![]() |
Product ID | ORK00085 |
---|---|
Accession No | AB007942 |
Description | DnaJ (Hsp40) homolog, subfamily C, member 6, transcript variant 2 |
Clone name | hh00220 |
Vector information | |
cDNA sequence | DNA sequence (5747 bp) Predicted protein sequence (937 aa) |
Flexi ORF Clone | FXC00085 |
Source | Human adult brain |
Rouge ID |
mKIAA0473
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2848 bp |
---|---|
Genome contig ID | gi89161185f_65403025 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (251117 - 251166) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 65503025 | 65654140 | 19 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001623 | 885 | 926 | PF00226 | Heat shock protein DnaJ |
HMMSmart | IPR001623 | 872 | 933 | SM00271 | Heat shock protein DnaJ |
ProfileScan | IPR014019 | 79 | 246 | PS51181 | Phosphatase tensin type |
IPR000387 | 163 | 234 | PS50056 | Protein-tyrosine phosphatase | |
IPR014020 | 252 | 390 | PS51182 | C2 tensin-type | |
IPR001623 | 873 | 937 | PS50076 | Heat shock protein DnaJ | |
ScanRegExp | IPR000387 | 186 | 198 | PS00383 | Protein-tyrosine phosphatase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 190 | DGRAASSILVGAMFIFCNLYSTP | 212 | PRIMARY | 23 |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTGCTCATTCCCTACACAGAC |
Primer_r | GATTGAACCTGGAAGTCTGGG |
PCR product length | 183 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |