|
Order Kazusa clone(s) from : |
| Product ID | ORK00085 |
|---|---|
| Accession No | AB007942 |
| Description | DnaJ (Hsp40) homolog, subfamily C, member 6 |
| Clone name | hh00220 |
| Vector information | |
| ORF sequence | DNA sequence (5747 bp) Protein sequence (937 aa) |
|
HaloTag ORF Clone |
FHC00085
|
| Flexi ORF Clone | FXC00085 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0473
by Kazusa Mouse cDNA Project
|
Length: 5747 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2848 bp |
|---|---|
| Genome contig ID | gi89161185f_65403025 |
| PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (251117 - 251166) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | f | 65503025 | 65654140 | 19 | 99.4 | Perfect prediction |
Length: 937 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001623 | 885 | 926 | PF00226 | Heat shock protein DnaJ |
| HMMSmart | IPR001623 | 872 | 933 | SM00271 | Heat shock protein DnaJ |
| ProfileScan | IPR014019 | 79 | 246 | PS51181 | Phosphatase tensin type |
| IPR000387 | 163 | 234 | PS50056 | Protein-tyrosine phosphatase | |
| IPR014020 | 252 | 390 | PS51182 | C2 tensin-type | |
| IPR001623 | 873 | 937 | PS50076 | Heat shock protein DnaJ | |
| ScanRegExp | IPR000387 | 186 | 198 | PS00383 | Protein-tyrosine phosphatase |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 190 | DGRAASSILVGAMFIFCNLYSTP | 212 | PRIMARY | 23 |
|---|
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTGCTCATTCCCTACACAGAC |
| Primer_r | GATTGAACCTGGAAGTCTGGG |
| PCR product length | 183 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |