Gene/Protein Characteristic Table for KIAA0473
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00085
Accession No AB007942
Description DnaJ (Hsp40) homolog, subfamily C, member 6
Clone name hh00220
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
ORF sequence DNA sequence (5747 bp)
Protein sequence (937 aa)
Flexi ORF Clone FXC00085
Source Human adult brain
Rouge ID mKIAA0473 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5747 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2848 bp
Genome contig ID gi89161185f_65403025
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
GCTAAAATAAATGTAGCATCTAATTTTATCAGTTT
Flanking genome sequence
(251117 - 251166)
----+----*----+----*----+----*----+----*----+----*
AACATCTGATATGTCTTCTATCCATGTACAATATTTTAAATGGATTTTGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 f 65503025 65654140 19 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 937 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75061 0 100.0 Putative tyrosi...
Homo sapiens
XP_001161700 0 99.6 DnaJ (Hsp40) ho...
Pan troglodytes
XP_001090170 0 99.6 similar to DnaJ...
Macaca mulatta
CAI18999 0 98.7 DnaJ (Hsp40) ho...
Homo sapiens
XP_001161657 0 98.3 DnaJ (Hsp40) ho...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB028998 5.9e-07 25.7 KIAA1075
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001623 885 926 PF00226 Heat shock protein DnaJ
HMMSmart IPR001623 872 933 SM00271 Heat shock protein DnaJ
ProfileScan IPR014019 79 246 PS51181 Phosphatase tensin type
IPR000387 163 234 PS50056 Protein-tyrosine phosphatase
IPR014020 252 390 PS51182 C2 tensin-type
IPR001623 873 937 PS50076 Heat shock protein DnaJ
ScanRegExp IPR000387 186 198 PS00383 Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 190 DGRAASSILVGAMFIFCNLYSTP 212 PRIMARY 23

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f TTGCTCATTCCCTACACAGAC
Primer_r GATTGAACCTGGAAGTCTGGG
PCR product length 183 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp