Order Kazusa clone(s) from : ![]() |
Product ID | ORK00822 |
---|---|
Accession No | AB037812 |
Description | Rho GTPase activating protein 20, transcript variant 1 |
Clone name | hh12985 |
Vector information | |
cDNA sequence | DNA sequence (5901 bp) Predicted protein sequence (1194 aa) |
HaloTag ORF Clone |
FHC00822
![]() |
Flexi ORF Clone | FXC00822 |
Source | Human adult brain |
Rouge ID |
mKIAA1391
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2315 bp |
---|---|
Genome contig ID | gi51511727r_109852988 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 109952988 | 110088174 | 15 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000159 | 197 | 286 | PF00788 | Ras-association |
IPR000198 | 380 | 530 | PF00620 | RhoGAP | |
HMMSmart | IPR001849 | 89 | 190 | SM00233 | Pleckstrin-like |
IPR000198 | 377 | 551 | SM00324 | RhoGAP | |
ProfileScan | IPR000159 | 197 | 298 | PS50200 | Ras-association |
IPR000198 | 368 | 554 | PS50238 | RhoGAP |
![]() |
Primer_f | ACAGCGTTCACTCTCAATATG |
---|---|
Primer_r | TCTGGCTGACTGTAATCTAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |