Gene/Protein Characteristic Table for KIAA0426
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00534
Accession No AB007886
Description zinc finger and SCAN domain containing 12
Clone name hh01274
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5471 bp)
Predicted protein sequence (613 aa)
Flexi ORF Clone FXC00534
Source Human adult brain
Rouge ID mKIAA0426 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 3511 bp
Genome contig ID gi89161210r_28354711
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
GGTATTATTAATAAATTCATTATTTTCAAAGATGG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTGTGTTCTGTAAAAAGCTTTTCCAGTATCTGCAAATCACACAGTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 6 r 28454711 28475490 7 99.1 Internal No-hit
Features of the protein sequence
Description

Length: 613 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF82491 0 99.8 unnamed protein...
 Homo sapiens
ABZ92462 0 99.8 zinc finger and...
 synthetic construct
A2T6V8 0 98.8 Zinc finger and...
 Pan troglodytes
A1YFW2 0 99.0 Zinc finger and...
 Pan paniscus
A1YEP8 0 99.0 Zinc finger and...
 Gorilla gorilla...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 1.6e-49 53.8 KIAA1611
AB040941 7.1e-48 44.0 KIAA1508
AB014528 3.9e-47 53.1 KIAA0628
AB107355 5.8e-47 42.9 KIAA2033
AB075827 7.1e-47 41.7 KIAA1947
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 283 306 PD000003 Zinc finger
IPR007087 311 334 PD000003 Zinc finger
IPR007087 339 362 PD000003 Zinc finger
IPR007087 367 390 PD000003 Zinc finger
IPR007087 395 418 PD000003 Zinc finger
IPR007087 423 445 PD000003 Zinc finger
IPR007087 451 473 PD000003 Zinc finger
IPR007087 478 501 PD000003 Zinc finger
IPR007087 506 529 PD000003 Zinc finger
IPR007087 534 557 PD000003 Zinc finger
HMMPfam IPR003309 49 144 PF02023 Transcriptional regulator SCAN
IPR007087 283 305 PF00096 Zinc finger
IPR007087 311 333 PF00096 Zinc finger
IPR007087 339 361 PF00096 Zinc finger
IPR007087 367 389 PF00096 Zinc finger
IPR007087 395 417 PF00096 Zinc finger
IPR007087 423 445 PF00096 Zinc finger
IPR007087 451 472 PF00096 Zinc finger
IPR007087 478 500 PF00096 Zinc finger
IPR007087 506 528 PF00096 Zinc finger
IPR007087 534 556 PF00096 Zinc finger
HMMSmart IPR003309 51 163 SM00431 Transcriptional regulator SCAN
IPR015880 283 305 SM00355 Zinc finger
IPR015880 311 333 SM00355 Zinc finger
IPR015880 339 361 SM00355 Zinc finger
IPR015880 367 389 SM00355 Zinc finger
IPR015880 395 417 SM00355 Zinc finger
IPR015880 423 445 SM00355 Zinc finger
IPR015880 451 472 SM00355 Zinc finger
IPR015880 478 500 SM00355 Zinc finger
IPR015880 506 528 SM00355 Zinc finger
IPR015880 534 556 SM00355 Zinc finger
ProfileScan IPR003309 55 137 PS50804 Transcriptional regulator SCAN
IPR007087 283 310 PS50157 Zinc finger
IPR007087 311 338 PS50157 Zinc finger
IPR007087 339 366 PS50157 Zinc finger
IPR007087 367 394 PS50157 Zinc finger
IPR007087 395 422 PS50157 Zinc finger
IPR007087 423 450 PS50157 Zinc finger
IPR007087 451 477 PS50157 Zinc finger
IPR007087 478 505 PS50157 Zinc finger
IPR007087 506 533 PS50157 Zinc finger
IPR007087 534 561 PS50157 Zinc finger
IPR007087 562 592 PS50157 Zinc finger
ScanRegExp IPR007087 285 305 PS00028 Zinc finger
IPR007087 313 333 PS00028 Zinc finger
IPR007087 341 361 PS00028 Zinc finger
IPR007087 369 389 PS00028 Zinc finger
IPR007087 397 417 PS00028 Zinc finger
IPR007087 425 446 PS00028 Zinc finger
IPR007087 480 500 PS00028 Zinc finger
IPR007087 508 528 PS00028 Zinc finger
IPR007087 536 556 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGGTTCCTGTATTTAGTGCCC
Primer_r CAACAAGTTGATAATGTAGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f TGGTTCCTGTATTTAGTGCCC
Primer_r CAACAAGTTGATAATGTAGCC
PCR product length 179 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp