Gene/Protein Characteristic Table for KIAA1508
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07491
Accession No AB040941
Description zinc finger protein 530
Clone name hk06576
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4368 bp)
Predicted protein sequence (573 aa)
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4368 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 1697 bp
Genome contig ID gi42406306f_62707835
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAGCGAGACTGCGTCTC
Flanking genome sequence
(104368 - 104417)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGATCCATTCAGGCCAGTCACAGTGGCTCATGCG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 62807835 62812201 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 573 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW72517 0 99.8 zinc finger pro...
 Homo sapiens
AAC24609 0 99.6 R28830_2 [Homo ...
 Homo sapiens
Q6P9A1 0 99.6 Zinc finger pro...
 Homo sapiens
AAH60865 0 99.6 Zinc finger pro...
 Homo sapiens
BAG53369 0 99.5 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB075836 2.2e-88 51.0 KIAA1956
AB075827 1e-72 48.7 KIAA1947
AB002324 7.3e-72 55.0 KIAA0326
D31763 9.8e-71 44.7 KIAA0065
AB046831 1.1e-70 45.7 KIAA1611
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 213 235 PD000003 Zinc finger
IPR007087 241 264 PD000003 Zinc finger
IPR007087 269 292 PD000003 Zinc finger
IPR007087 297 320 PD000003 Zinc finger
IPR007087 325 348 PD000003 Zinc finger
IPR007087 353 376 PD000003 Zinc finger
IPR007087 381 404 PD000003 Zinc finger
IPR007087 409 432 PD000003 Zinc finger
IPR007087 437 460 PD000003 Zinc finger
IPR007087 465 488 PD000003 Zinc finger
IPR007087 493 516 PD000003 Zinc finger
IPR007087 521 544 PD000003 Zinc finger
IPR007087 549 571 PD000003 Zinc finger
HMMPfam IPR007087 213 235 PF00096 Zinc finger
IPR007087 241 263 PF00096 Zinc finger
IPR007087 269 291 PF00096 Zinc finger
IPR007087 297 319 PF00096 Zinc finger
IPR007087 325 347 PF00096 Zinc finger
IPR007087 353 375 PF00096 Zinc finger
IPR007087 381 403 PF00096 Zinc finger
IPR007087 409 431 PF00096 Zinc finger
IPR007087 437 459 PF00096 Zinc finger
IPR007087 465 487 PF00096 Zinc finger
IPR007087 493 515 PF00096 Zinc finger
IPR007087 521 543 PF00096 Zinc finger
IPR007087 549 571 PF00096 Zinc finger
HMMSmart IPR015880 213 235 SM00355 Zinc finger
IPR015880 241 263 SM00355 Zinc finger
IPR015880 269 291 SM00355 Zinc finger
IPR015880 297 319 SM00355 Zinc finger
IPR015880 325 347 SM00355 Zinc finger
IPR015880 353 375 SM00355 Zinc finger
IPR015880 381 403 SM00355 Zinc finger
IPR015880 409 431 SM00355 Zinc finger
IPR015880 437 459 SM00355 Zinc finger
IPR015880 465 487 SM00355 Zinc finger
IPR015880 493 515 SM00355 Zinc finger
IPR015880 521 543 SM00355 Zinc finger
IPR015880 549 571 SM00355 Zinc finger
ProfileScan IPR007087 213 240 PS50157 Zinc finger
IPR007087 241 268 PS50157 Zinc finger
IPR007087 269 296 PS50157 Zinc finger
IPR007087 297 324 PS50157 Zinc finger
IPR007087 325 352 PS50157 Zinc finger
IPR007087 353 380 PS50157 Zinc finger
IPR007087 381 408 PS50157 Zinc finger
IPR007087 409 436 PS50157 Zinc finger
IPR007087 437 464 PS50157 Zinc finger
IPR007087 465 492 PS50157 Zinc finger
IPR007087 493 520 PS50157 Zinc finger
IPR007087 521 548 PS50157 Zinc finger
IPR007087 549 573 PS50157 Zinc finger
ScanRegExp IPR007087 215 235 PS00028 Zinc finger
IPR007087 243 263 PS00028 Zinc finger
IPR007087 271 291 PS00028 Zinc finger
IPR007087 299 319 PS00028 Zinc finger
IPR007087 327 347 PS00028 Zinc finger
IPR007087 355 375 PS00028 Zinc finger
IPR007087 383 403 PS00028 Zinc finger
IPR007087 411 431 PS00028 Zinc finger
IPR007087 439 459 PS00028 Zinc finger
IPR007087 467 487 PS00028 Zinc finger
IPR007087 495 515 PS00028 Zinc finger
IPR007087 523 543 PS00028 Zinc finger
IPR007087 551 571 PS00028 Zinc finger

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 13 HTIVNLCFLSISLLSGCWCGAVD 35 PRIMARY 23
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCCCTGCAATGTTTAGAATCC
Primer_r TCCCTATTATTCAACCCAGCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f GCCCTGCAATGTTTAGAATCC
Primer_r TCCCTATTATTCAACCCAGCG
PCR product length 153 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp