Order Kazusa clone(s) from : ![]() |
Product ID | ORK07491 |
---|---|
Accession No | AB040941 |
Description | zinc finger protein 530 |
Clone name | hk06576 |
Vector information | |
cDNA sequence | DNA sequence (4368 bp) Predicted protein sequence (573 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1697 bp |
---|---|
Genome contig ID | gi42406306f_62707835 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (104368 - 104417) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 62807835 | 62812201 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 213 | 235 | PD000003 | Zinc finger |
IPR007087 | 241 | 264 | PD000003 | Zinc finger | |
IPR007087 | 269 | 292 | PD000003 | Zinc finger | |
IPR007087 | 297 | 320 | PD000003 | Zinc finger | |
IPR007087 | 325 | 348 | PD000003 | Zinc finger | |
IPR007087 | 353 | 376 | PD000003 | Zinc finger | |
IPR007087 | 381 | 404 | PD000003 | Zinc finger | |
IPR007087 | 409 | 432 | PD000003 | Zinc finger | |
IPR007087 | 437 | 460 | PD000003 | Zinc finger | |
IPR007087 | 465 | 488 | PD000003 | Zinc finger | |
IPR007087 | 493 | 516 | PD000003 | Zinc finger | |
IPR007087 | 521 | 544 | PD000003 | Zinc finger | |
IPR007087 | 549 | 571 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 213 | 235 | PF00096 | Zinc finger |
IPR007087 | 241 | 263 | PF00096 | Zinc finger | |
IPR007087 | 269 | 291 | PF00096 | Zinc finger | |
IPR007087 | 297 | 319 | PF00096 | Zinc finger | |
IPR007087 | 325 | 347 | PF00096 | Zinc finger | |
IPR007087 | 353 | 375 | PF00096 | Zinc finger | |
IPR007087 | 381 | 403 | PF00096 | Zinc finger | |
IPR007087 | 409 | 431 | PF00096 | Zinc finger | |
IPR007087 | 437 | 459 | PF00096 | Zinc finger | |
IPR007087 | 465 | 487 | PF00096 | Zinc finger | |
IPR007087 | 493 | 515 | PF00096 | Zinc finger | |
IPR007087 | 521 | 543 | PF00096 | Zinc finger | |
IPR007087 | 549 | 571 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 213 | 235 | SM00355 | Zinc finger |
IPR015880 | 241 | 263 | SM00355 | Zinc finger | |
IPR015880 | 269 | 291 | SM00355 | Zinc finger | |
IPR015880 | 297 | 319 | SM00355 | Zinc finger | |
IPR015880 | 325 | 347 | SM00355 | Zinc finger | |
IPR015880 | 353 | 375 | SM00355 | Zinc finger | |
IPR015880 | 381 | 403 | SM00355 | Zinc finger | |
IPR015880 | 409 | 431 | SM00355 | Zinc finger | |
IPR015880 | 437 | 459 | SM00355 | Zinc finger | |
IPR015880 | 465 | 487 | SM00355 | Zinc finger | |
IPR015880 | 493 | 515 | SM00355 | Zinc finger | |
IPR015880 | 521 | 543 | SM00355 | Zinc finger | |
IPR015880 | 549 | 571 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 213 | 240 | PS50157 | Zinc finger |
IPR007087 | 241 | 268 | PS50157 | Zinc finger | |
IPR007087 | 269 | 296 | PS50157 | Zinc finger | |
IPR007087 | 297 | 324 | PS50157 | Zinc finger | |
IPR007087 | 325 | 352 | PS50157 | Zinc finger | |
IPR007087 | 353 | 380 | PS50157 | Zinc finger | |
IPR007087 | 381 | 408 | PS50157 | Zinc finger | |
IPR007087 | 409 | 436 | PS50157 | Zinc finger | |
IPR007087 | 437 | 464 | PS50157 | Zinc finger | |
IPR007087 | 465 | 492 | PS50157 | Zinc finger | |
IPR007087 | 493 | 520 | PS50157 | Zinc finger | |
IPR007087 | 521 | 548 | PS50157 | Zinc finger | |
IPR007087 | 549 | 573 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 215 | 235 | PS00028 | Zinc finger |
IPR007087 | 243 | 263 | PS00028 | Zinc finger | |
IPR007087 | 271 | 291 | PS00028 | Zinc finger | |
IPR007087 | 299 | 319 | PS00028 | Zinc finger | |
IPR007087 | 327 | 347 | PS00028 | Zinc finger | |
IPR007087 | 355 | 375 | PS00028 | Zinc finger | |
IPR007087 | 383 | 403 | PS00028 | Zinc finger | |
IPR007087 | 411 | 431 | PS00028 | Zinc finger | |
IPR007087 | 439 | 459 | PS00028 | Zinc finger | |
IPR007087 | 467 | 487 | PS00028 | Zinc finger | |
IPR007087 | 495 | 515 | PS00028 | Zinc finger | |
IPR007087 | 523 | 543 | PS00028 | Zinc finger | |
IPR007087 | 551 | 571 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 13 | HTIVNLCFLSISLLSGCWCGAVD | 35 | PRIMARY | 23 |
---|
![]() |
Primer_f | GCCCTGCAATGTTTAGAATCC |
---|---|
Primer_r | TCCCTATTATTCAACCCAGCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCCTGCAATGTTTAGAATCC |
Primer_r | TCCCTATTATTCAACCCAGCG |
PCR product length | 153 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |