Order Kazusa clone(s) from : ![]() |
Product ID | ORK01090 |
---|---|
Accession No | AB011123 |
Description | TRAF2 and NCK interacting kinase, transcript variant 1 |
Clone name | hh00867s1 |
Vector information | |
cDNA sequence | DNA sequence (5727 bp) Predicted protein sequence (1385 aa) |
Flexi ORF Clone | FXC01090 |
Source | Human adult brain |
Rouge ID |
mKIAA0551
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00867, former representative clones for KIAA0551 with hh00867s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1378 bp |
---|---|
Genome contig ID | gi89161205r_172162986 |
PolyA signal sequence (TATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 172262986 | 172660812 | 33 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 50 | 313 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 50 | 314 | PF00069 | Protein kinase |
IPR001180 | 1072 | 1363 | PF00780 | Citron-like | |
HMMSmart | IPR001245 | 50 | 314 | SM00219 | Tyrosine protein kinase |
IPR002290 | 50 | 314 | SM00220 | Serine/threonine protein kinase | |
IPR001180 | 1067 | 1365 | SM00036 | Citron-like | |
ProfileScan | IPR000719 | 50 | 314 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 56 | 79 | PS00107 | Protein kinase |
IPR008271 | 174 | 186 | PS00108 | Serine/threonine protein kinase |
![]() |
---|
Primer_f | GTATGTTGGGTAATTTGGAGG |
---|---|
Primer_r | TCCTGTGTTCTCCCTGTGTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTATGTTGGGTAATTTGGAGG |
Primer_r | TCCTGTGTTCTCCCTGTGTGG |
PCR product length | 193 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |