Order Kazusa clone(s) from : ![]() |
Product ID | ORK00520 |
---|---|
Accession No | AB002376 |
Description | ELKS/RAB6-interacting/CAST family member 2 |
Clone name | hh00502s1 |
Vector information | |
cDNA sequence | DNA sequence (6137 bp) Predicted protein sequence (970 aa) |
HaloTag ORF Clone |
FHC00520
![]() |
Flexi ORF Clone | FXC00520 |
Source | Human adult brain |
Rouge ID |
mKIAA0378
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00502, former representative clones for KIAA0378 with hh00502s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3007 bp |
---|---|
Genome contig ID | gi89161205r_55417376 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 55517376 | 56477431 | 17 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | AATAAGGCGATCAGCACAAAG |
---|---|
Primer_r | CATGTGGGTTGTGATATTGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATAAGGCGATCAGCACAAAG |
Primer_r | CATGTGGGTTGTGATATTGAC |
PCR product length | 206 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |