Order Kazusa clone(s) from : ![]() |
Product ID | ORK04533 |
---|---|
Accession No | AB014535 |
Description | centrosomal protein 135kDa |
Clone name | hj03253 |
Vector information | |
cDNA sequence | DNA sequence (5138 bp) Predicted protein sequence (864 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0635
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1765 bp |
---|---|
Genome contig ID | gi89161207f_56425789 |
PolyA signal sequence (AATAAA,-8) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (168240 - 168289) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 56525789 | 56594027 | 19 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 221 | 434 | PD023692 | NULL |
![]() |
---|
![]() |
Primer_f | TACACCACCCCTTAGTTCCAC |
---|---|
Primer_r | GAGGTAGAATTTGTGTCCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTAATAAAGACCTGGAGAAGC |
Primer_r | TTCCAACTGCTGTGCTAACTG |
PCR product length | 143 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |