Order Kazusa clone(s) from : ![]() |
Product ID | ORK05024 |
---|---|
Accession No | AB033101 |
Description | filamin A interacting protein 1 |
Clone name | hk10413 |
Vector information | |
cDNA sequence | DNA sequence (4051 bp) Predicted protein sequence (1140 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 599 bp |
---|---|
Genome contig ID | gi89161210r_75974528 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 76074528 | 76129439 | 4 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 148 | 322 | PD023692 | NULL |
NULL | 323 | 358 | PD138041 | NULL |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | AQYAIYIVSRLILLHFLLQARED | 23 | PRIMARY | 23 |
---|
![]() |
Primer_f | AAAGCAGGAAAGCCAGTAGTG |
---|---|
Primer_r | TTTCACGGCAGCAGTAGCATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGACTCAATCACACGCTCTTC |
Primer_r | GATGTGAAAGAGGCAAATGAC |
PCR product length | 152 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |