KIAA1275

Product ID	ORK05024
Accession No	AB033101
Description	filamin A interacting protein 1
Clone name	hk10413
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4051 bp) Predicted protein sequence (1140 aa)
Source	Human adult brain

Length: 4051 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	599 bp
Genome contig ID	gi89161210r_75974528
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGTGAACATGTAATAAAATGGAAATGAAATATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCCTAAGAACAGAGTTTTACTTATTTGTGTGTGTCTGTGTGTATTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	76074528	76129439	4	100.0	Perfect prediction

Length: 1140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7Z7B0	99.1	Filamin-A-inter...	Homo sapiens
BAF82921	98.9	unnamed protein...	Homo sapiens
CAL38276	98.9	hypothetical pr...	synthetic construct
XP_001144185	98.9	filamin A inter...	Pan troglodytes
XP_001113175	98.5	similar to fila...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037854	1.2e-06	29.8	KIAA1433
AB002376	0.00021	25.0	KIAA0378
AB046781	0.0004	24.5	KIAA1561

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	148	322	PD023692	NULL
BlastProDom	NULL	323	358	PD138041	NULL

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	AQYAIYIVSRLILLHFLLQARED	23	PRIMARY	23

Primer_f	AAAGCAGGAAAGCCAGTAGTG
Primer_r	TTTCACGGCAGCAGTAGCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGACTCAATCACACGCTCTTC
Primer_r	GATGTGAAAGAGGCAAATGAC
PCR product length	152 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles