KIAA1615

Product ID	ORK07490
Accession No	AB046835
Description	zinc finger protein 529
Clone name	fj13419
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3934 bp) Predicted protein sequence (484 aa)
Source	Human fetal brain

Length: 3934 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2478 bp
Genome contig ID	gi42406306r_41627134
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCTTGTATACAGACATTAAAATTAGTGAGAGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATCCTTGTGTCTTGGCTTTTACTTTTTGAAGTCATTAACAAATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	41727134	41731063	1	99.0	Perfect prediction

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_066002	1.1e-212	99.8	zinc finger pro...	Homo sapiens
Q6P280	1.5e-212	99.8	Zinc finger pro...	Homo sapiens
XP_512621	1e-209	98.8	zinc finger pro...	Pan troglodytes
BAB15068	7.5e-202	99.8	unnamed protein...	Homo sapiens
XP_587640	1.3e-160	78.6	similar to Zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037852	1.8e-65	46.3	KIAA1431
AB046779	6e-65	53.3	KIAA1559
AB037817	3.8e-62	46.6	KIAA1396
AB037770	1e-61	48.9	KIAA1349
AB107355	2.4e-61	48.2	KIAA2033

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	203	226	PD000003	Zinc finger
	IPR007087	231	254	PD000003	Zinc finger
	IPR007087	259	282	PD000003	Zinc finger
	IPR007087	287	310	PD000003	Zinc finger
	IPR007087	315	338	PD000003	Zinc finger
	IPR007087	343	366	PD000003	Zinc finger
	IPR007087	371	394	PD000003	Zinc finger
	IPR007087	399	422	PD000003	Zinc finger
	IPR007087	427	450	PD000003	Zinc finger
HMMPfam	IPR007087	203	225	PF00096	Zinc finger
	IPR007087	231	253	PF00096	Zinc finger
	IPR007087	259	281	PF00096	Zinc finger
	IPR007087	287	309	PF00096	Zinc finger
	IPR007087	315	337	PF00096	Zinc finger
	IPR007087	343	365	PF00096	Zinc finger
	IPR007087	371	393	PF00096	Zinc finger
	IPR007087	399	421	PF00096	Zinc finger
	IPR007087	427	449	PF00096	Zinc finger
HMMSmart	IPR015880	203	225	SM00355	Zinc finger
	IPR015880	231	253	SM00355	Zinc finger
	IPR015880	259	281	SM00355	Zinc finger
	IPR015880	287	309	SM00355	Zinc finger
	IPR015880	315	337	SM00355	Zinc finger
	IPR015880	343	365	SM00355	Zinc finger
	IPR015880	371	393	SM00355	Zinc finger
	IPR015880	399	421	SM00355	Zinc finger
	IPR015880	427	449	SM00355	Zinc finger
ProfileScan	IPR007087	120	147	PS50157	Zinc finger
	IPR007087	203	230	PS50157	Zinc finger
	IPR007087	231	258	PS50157	Zinc finger
	IPR007087	259	286	PS50157	Zinc finger
	IPR007087	287	314	PS50157	Zinc finger
	IPR007087	315	342	PS50157	Zinc finger
	IPR007087	343	370	PS50157	Zinc finger
	IPR007087	371	398	PS50157	Zinc finger
	IPR007087	399	426	PS50157	Zinc finger
	IPR007087	427	454	PS50157	Zinc finger
	IPR007087	455	482	PS50157	Zinc finger
ScanRegExp	IPR007087	205	225	PS00028	Zinc finger
	IPR007087	233	253	PS00028	Zinc finger
	IPR007087	261	281	PS00028	Zinc finger
	IPR007087	289	309	PS00028	Zinc finger
	IPR007087	317	337	PS00028	Zinc finger
	IPR007087	345	365	PS00028	Zinc finger
	IPR007087	373	393	PS00028	Zinc finger
	IPR007087	401	421	PS00028	Zinc finger
	IPR007087	429	449	PS00028	Zinc finger

Primer_f	GCCAACCGAAAATTTACACTG
Primer_r	AACAGACTTTAAGAGAGGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GCCAACCGAAAATTTACACTG
Primer_r	AACAGACTTTAAGAGAGGGAG
PCR product length	150 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles