Gene/Protein Characteristic Table for KIAA1396
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07479
Accession No AB037817
Description zinc finger protein 471
Clone name hj08221
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5041 bp)
Predicted protein sequence (551 aa)
Source Human adult brain
Rouge ID mKIAA1396 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5041 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 3384 bp
Genome contig ID gi42406306f_61627501
PolyA signal sequence
(AATAAA,-29)		 
+----*----+----*----+----*----+----
ACTAGAAATAAAGTCAGCATCCCATTTGACTCCTT
Flanking genome sequence
(105013 - 105062)		 
----+----*----+----*----+----*----+----*----+----*
ACACAGAAGTTCATTCTATACTCATTACAGATGTAAGAGGTTAAGATGGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 61721727 61732512 2 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 551 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI25223 0 99.6 Zinc finger pro...
 Homo sapiens
Q9BX82 0 99.5 Zinc finger pro...
 Homo sapiens
CAD38551 0 99.3 hypothetical pr...
 Homo sapiens
CAL38280 0 99.1 hypothetical pr...
 synthetic construct
NP_001092815 0 98.5 zinc finger pro...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037852 6.5e-98 61.0 KIAA1431
AB075827 1e-85 54.1 KIAA1947
AB046831 2.1e-85 59.7 KIAA1611
AB107355 4.1e-83 46.5 KIAA2033
D31763 6.5e-79 51.2 KIAA0065
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 131 154 PD000003 Zinc finger
IPR007087 159 182 PD000003 Zinc finger
IPR007087 187 210 PD000003 Zinc finger
IPR007087 215 238 PD000003 Zinc finger
IPR007087 243 266 PD000003 Zinc finger
IPR007087 271 295 PD000003 Zinc finger
IPR007087 328 351 PD000003 Zinc finger
IPR007087 356 379 PD000003 Zinc finger
IPR007087 384 407 PD000003 Zinc finger
IPR007087 412 435 PD000003 Zinc finger
IPR007087 440 463 PD000003 Zinc finger
IPR007087 468 491 PD000003 Zinc finger
IPR007087 496 519 PD000003 Zinc finger
IPR007087 524 547 PD000003 Zinc finger
HMMPfam IPR007087 131 153 PF00096 Zinc finger
IPR007087 159 181 PF00096 Zinc finger
IPR007087 187 209 PF00096 Zinc finger
IPR007087 215 237 PF00096 Zinc finger
IPR007087 243 265 PF00096 Zinc finger
IPR007087 271 294 PF00096 Zinc finger
IPR007087 300 322 PF00096 Zinc finger
IPR007087 328 350 PF00096 Zinc finger
IPR007087 356 378 PF00096 Zinc finger
IPR007087 384 406 PF00096 Zinc finger
IPR007087 412 434 PF00096 Zinc finger
IPR007087 440 462 PF00096 Zinc finger
IPR007087 468 490 PF00096 Zinc finger
IPR007087 496 518 PF00096 Zinc finger
IPR007087 524 546 PF00096 Zinc finger
HMMSmart IPR015880 131 153 SM00355 Zinc finger
IPR015880 159 181 SM00355 Zinc finger
IPR015880 187 209 SM00355 Zinc finger
IPR015880 215 237 SM00355 Zinc finger
IPR015880 243 265 SM00355 Zinc finger
IPR015880 271 294 SM00355 Zinc finger
IPR015880 300 322 SM00355 Zinc finger
IPR015880 328 350 SM00355 Zinc finger
IPR015880 356 378 SM00355 Zinc finger
IPR015880 384 406 SM00355 Zinc finger
IPR015880 412 434 SM00355 Zinc finger
IPR015880 440 462 SM00355 Zinc finger
IPR015880 468 490 SM00355 Zinc finger
IPR015880 496 518 SM00355 Zinc finger
IPR015880 524 546 SM00355 Zinc finger
ProfileScan IPR007087 131 158 PS50157 Zinc finger
IPR007087 159 186 PS50157 Zinc finger
IPR007087 187 214 PS50157 Zinc finger
IPR007087 215 242 PS50157 Zinc finger
IPR007087 243 270 PS50157 Zinc finger
IPR007087 271 299 PS50157 Zinc finger
IPR007087 300 327 PS50157 Zinc finger
IPR007087 328 355 PS50157 Zinc finger
IPR007087 356 383 PS50157 Zinc finger
IPR007087 384 411 PS50157 Zinc finger
IPR007087 412 439 PS50157 Zinc finger
IPR007087 440 467 PS50157 Zinc finger
IPR007087 468 495 PS50157 Zinc finger
IPR007087 496 523 PS50157 Zinc finger
IPR007087 524 551 PS50157 Zinc finger
ScanRegExp IPR007087 133 153 PS00028 Zinc finger
IPR007087 161 181 PS00028 Zinc finger
IPR007087 189 209 PS00028 Zinc finger
IPR007087 217 237 PS00028 Zinc finger
IPR007087 245 265 PS00028 Zinc finger
IPR007087 273 294 PS00028 Zinc finger
IPR007087 302 322 PS00028 Zinc finger
IPR007087 330 350 PS00028 Zinc finger
IPR007087 358 378 PS00028 Zinc finger
IPR007087 386 406 PS00028 Zinc finger
IPR007087 414 434 PS00028 Zinc finger
IPR007087 442 462 PS00028 Zinc finger
IPR007087 470 490 PS00028 Zinc finger
IPR007087 498 518 PS00028 Zinc finger
IPR007087 526 546 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGGGAGGTTTTGTAGAAGGTC
Primer_r AAGGAGTCAAATGGGATGCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f AGGGAGGTTTTGTAGAAGGTC
Primer_r AAGGAGTCAAATGGGATGCTG
PCR product length 135 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp