KIAA1361

Product ID	ORK00219
Accession No	AB037782
Description	TAO kinase 1, transcript variant 1
Clone name	fj02367
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4620 bp) Predicted protein sequence (1005 aa)
HaloTag ORF Clone	FHC00219
Flexi ORF Clone	FXC00219
Source	Human fetal brain
Rouge ID	mKIAA1361 by Kazusa Mouse cDNA Project

Length: 4620 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1462 bp
Genome contig ID	gi51511734f_24702639
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTACTGAAAAGGAACTAGGAAGTTTGGCCAATT
Flanking genome sequence (192991 - 193040)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGTAAAATAAGTTATAGTGGTCAGGGAATCTCTTGACGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	24754920	24895628	20	99.5	Terminal No-hit

Length: 1005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L7X3	100.0	Serine/threonin...	Homo sapiens
XP_537752	99.7	similar to TAO ...	Canis lupus fam...
AAG38502	99.8	STE20-like kina...	Homo sapiens
Q5F2E8	99.4	Serine/threonin...	Mus musculus
XP_001138763	99.2	TAO kinase 1 is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020688	2.5e-57	70.4	KIAA0881
D86959	3.3e-13	25.2	KIAA0204
AB011123	1.8e-12	30.9	KIAA0551
AB014587	6.4e-12	30.3	KIAA0687
AB032968	6.7e-11	36.7	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	35	275	PD000001	Protein kinase
BlastProDom	IPR005602	450	604	PD038149	Protein of unknown function DUF334
HMMPfam	IPR000719	32	285	PF00069	Protein kinase
HMMSmart	IPR001245	32	283	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	32	285	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	32	285	PS50011	Protein kinase
ScanRegExp	IPR000719	38	62	PS00107	Protein kinase
ScanRegExp	IPR008271	151	163	PS00108	Serine/threonine protein kinase

Primer_f	TGAGGAGATGAAGCTTACGTG
Primer_r	AATATGGCATCAAACACCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-