Order Kazusa clone(s) from : ![]() |
Product ID | ORK00265 |
---|---|
Accession No | AB051469 |
Description | myotubularin related protein 12, transcript variant 1 |
Clone name | fh23774 |
Vector information | |
cDNA sequence | DNA sequence (5034 bp) Predicted protein sequence (775 aa) |
HaloTag ORF Clone |
FHC00265
![]() |
Flexi ORF Clone | FXC00265 |
Source | Human fetal brain |
Rouge ID |
mKIAA1682
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2687 bp |
---|---|
Genome contig ID | gi51511721r_32162869 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (285936 - 285887) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 32256535 | 32348804 | 19 | 98.6 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CTCCAGCGACATTCCTCTAAG |
---|---|
Primer_r | TAGCGTGACACAAATCCAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | GTTTGTTGTTACCGCATATCG |
Primer_r | CTTCTCTTGTAAACTCTGGAC |
PCR product length | 158 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |