KIAA1073

Product ID	ORK01624
Accession No	AB028996
Description	myotubularin related protein 2, transcript variant 1
Clone name	hj06550
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4680 bp) Predicted protein sequence (675 aa)
HaloTag ORF Clone	FHC01624
Flexi ORF Clone	FXC01624
Source	Human adult brain
Rouge ID	mKIAA1073 by Kazusa Mouse cDNA Project

Length: 4680 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2407 bp
Genome contig ID	gi51511727r_95105694
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGAAATGAATTGCAATAAAGCTCTGTTACAACGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGGATGGATGACACATTCCTCTACTGTAAACTTGCAGATAAGAAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	95205694	95297107	15	99.3	Perfect prediction

Length: 675 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH52990	100.0	Myotubularin re...	Homo sapiens
BAF83966	99.8	unnamed protein...	Homo sapiens
Q13614	99.8	Myotubularin-re...	Homo sapiens
1LW3	99.7	Crystal Structu...	Homo sapiens
Q5REB9	99.4	Myotubularin-re...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002369	7e-47	38.5	KIAA0371
AB014547	8.2e-44	34.5	KIAA0647
AB051469	4.1e-16	27.6	KIAA1682

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	100	171	PF02893	GRAM
HMMPfam	IPR010569	266	383	PF06602	Myotubularin-related
HMMSmart	IPR004182	103	171	SM00568	GRAM
HMMSmart	IPR003595	397	545	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000387	418	465	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	447	459	PS00383	Protein-tyrosine phosphatase

Primer_f	TTGGTTCAGTCTGTCTTGTGC
Primer_r	GGATGTCAGAGAAGGCAGTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-