KIAA0453

Product ID	ORK07340
Accession No	AB007922
Description	vacuolar protein sorting 13 homolog D (S. cerevisiae)
Clone name	ff02431
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ff02431 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (10969 bp) Predicted protein sequence (3209 aa)
Source	Human fetal brain
Rouge ID	mKIAA0453 by Kazusa Mouse cDNA Project
Note	We replaced hg00489, former representative clones for KIAA0453 with ff02431. (2003/8/28)

Length: 10969 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1337 bp
Genome contig ID	gi89161185f_12159765
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTAAATTTTTATTTTAATAAAGCTAATCAATTTCT
Flanking genome sequence (333239 - 333288)	----+--------+--------+--------+--------+----* ACAACCTTGTCACATGTAGCTGAGTCTGGGATGACTCAGTGGATCAGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	12259765	12493002	52	99.9	Perfect prediction

Length: 3209 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5THJ4	100.0	Vacuolar protei...	Homo sapiens
NP_056193	100.0	vacuolar protei...	Homo sapiens
CAE75586	99.9	VPS13D-1A prote...	Homo sapiens
XP_514406	99.6	vacuolar protei...	Pan troglodytes
XP_001490982	95.0	vacuolar protei...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023203	5.1e-10	21.3	KIAA0986
AB037842	2.3e-06	21.9	KIAA1421
AB011104	0.00017	20.9	KIAA0532

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	1459	1498	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMPfam	IPR009543	2084	2394	PF06650	Vacuolar protein sorting-associated protein
HMMSmart	IPR000449	1460	1497	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	1455	1498	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	CAAGGCATTTTATTCCACAGG
Primer_r	TTTGTAAGTATGATCTGGGCC
PCR product length	173 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles