KIAA1995

Product ID	ORK02059
Accession No	AB082526
Description	NIMA-related kinase 9
Clone name	bh00088
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (5492 bp) Predicted protein sequence (1011 aa)
HaloTag ORF Clone	FHC02059
Flexi ORF Clone	FXC02059
Source	Human adult brain
Rouge ID	mKIAA1995 by Kazusa Mouse cDNA Project

Length: 5492 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2446 bp
Genome contig ID	gi51511730r_74518575
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATTTCTGTTTTAAATAAACATTTAAGCTCTTAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTACTGTGCTTCAGTAAGCCTGTGCATGGACCTTAGTCTCTGGGGATAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	74618575	74663483	22	99.5	Perfect prediction

Length: 1011 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL05428	100.0	NIMA-related ki...	Homo sapiens
Q8TD19	99.9	Serine/threonin...	Homo sapiens
AAL87410	99.8	NIMA-family kin...	Homo sapiens
XP_001097546	99.6	NIMA related ki...	Macaca mulatta
XP_001926782	95.7	similar to Seri...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067488	9.9e-30	42.3	KIAA1901
AB014523	4e-16	33.9	KIAA0623
AB032968	5.4e-16	31.1	KIAA1142
AB018265	7.4e-16	31.4	KIAA0722
AB033090	2.1e-15	30.0	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	87	331	PD000001	Protein kinase
HMMPfam	IPR000719	84	340	PF00069	Protein kinase
	IPR000408	476	527	PF00415	Regulator of chromosome condensation
	IPR000408	532	579	PF00415	Regulator of chromosome condensation
HMMSmart	IPR001245	84	340	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	84	340	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	84	340	PS50011	Protein kinase
	IPR000408	420	476	PS50012	Regulator of chromosome condensation
	IPR000408	477	530	PS50012	Regulator of chromosome condensation
	IPR000408	531	582	PS50012	Regulator of chromosome condensation
	IPR000408	583	647	PS50012	Regulator of chromosome condensation
	IPR000408	648	700	PS50012	Regulator of chromosome condensation
	IPR000408	701	758	PS50012	Regulator of chromosome condensation
ScanRegExp	IPR008271	204	216	PS00108	Serine/threonine protein kinase

Primer_f	TCCCACCTTCCTATAAACAGC
Primer_r	AGAAGATCCCATTGAACAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-