Order Kazusa clone(s) from : ![]() |
Product ID | ORK00958 |
---|---|
Accession No | AB075842 |
Description | zinc finger protein 483, transcript variant 1 |
Clone name | hm00158 |
Vector information | |
cDNA sequence | DNA sequence (3655 bp) Predicted protein sequence (746 aa) |
HaloTag ORF Clone |
FHC00958
![]() |
Flexi ORF Clone | FXC00958 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1262 bp |
---|---|
Genome contig ID | gi89161216f_113229366 |
PolyA signal sequence (ACTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (117169 - 117218) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 113327334 | 113346533 | 6 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 441 | 464 | PD000003 | Zinc finger |
IPR007087 | 469 | 492 | PD000003 | Zinc finger | |
IPR007087 | 497 | 520 | PD000003 | Zinc finger | |
IPR007087 | 525 | 548 | PD000003 | Zinc finger | |
IPR007087 | 581 | 604 | PD000003 | Zinc finger | |
IPR007087 | 637 | 660 | PD000003 | Zinc finger | |
IPR007087 | 665 | 688 | PD000003 | Zinc finger | |
IPR007087 | 693 | 716 | PD000003 | Zinc finger | |
HMMPfam | IPR003309 | 48 | 142 | PF02023 | Transcriptional regulator SCAN |
IPR001909 | 172 | 212 | PF01352 | KRAB box | |
IPR007087 | 441 | 463 | PF00096 | Zinc finger | |
IPR007087 | 469 | 491 | PF00096 | Zinc finger | |
IPR007087 | 497 | 519 | PF00096 | Zinc finger | |
IPR007087 | 525 | 547 | PF00096 | Zinc finger | |
IPR007087 | 553 | 575 | PF00096 | Zinc finger | |
IPR007087 | 581 | 603 | PF00096 | Zinc finger | |
IPR007087 | 609 | 631 | PF00096 | Zinc finger | |
IPR007087 | 637 | 659 | PF00096 | Zinc finger | |
IPR007087 | 665 | 687 | PF00096 | Zinc finger | |
IPR007087 | 693 | 715 | PF00096 | Zinc finger | |
IPR007087 | 721 | 743 | PF00096 | Zinc finger | |
HMMSmart | IPR003309 | 50 | 158 | SM00431 | Transcriptional regulator SCAN |
IPR001909 | 172 | 232 | SM00349 | KRAB box | |
IPR015880 | 441 | 463 | SM00355 | Zinc finger | |
IPR015880 | 469 | 491 | SM00355 | Zinc finger | |
IPR015880 | 497 | 519 | SM00355 | Zinc finger | |
IPR015880 | 525 | 547 | SM00355 | Zinc finger | |
IPR015880 | 553 | 575 | SM00355 | Zinc finger | |
IPR015880 | 581 | 603 | SM00355 | Zinc finger | |
IPR015880 | 609 | 631 | SM00355 | Zinc finger | |
IPR015880 | 637 | 659 | SM00355 | Zinc finger | |
IPR015880 | 665 | 687 | SM00355 | Zinc finger | |
IPR015880 | 693 | 715 | SM00355 | Zinc finger | |
IPR015880 | 721 | 743 | SM00355 | Zinc finger | |
ProfileScan | IPR003309 | 54 | 136 | PS50804 | Transcriptional regulator SCAN |
IPR001909 | 172 | 243 | PS50805 | KRAB box | |
IPR007087 | 441 | 468 | PS50157 | Zinc finger | |
IPR007087 | 469 | 496 | PS50157 | Zinc finger | |
IPR007087 | 497 | 524 | PS50157 | Zinc finger | |
IPR007087 | 525 | 552 | PS50157 | Zinc finger | |
IPR007087 | 553 | 580 | PS50157 | Zinc finger | |
IPR007087 | 581 | 608 | PS50157 | Zinc finger | |
IPR007087 | 609 | 636 | PS50157 | Zinc finger | |
IPR007087 | 637 | 664 | PS50157 | Zinc finger | |
IPR007087 | 665 | 692 | PS50157 | Zinc finger | |
IPR007087 | 693 | 720 | PS50157 | Zinc finger | |
IPR007087 | 721 | 746 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 443 | 463 | PS00028 | Zinc finger |
IPR007087 | 471 | 491 | PS00028 | Zinc finger | |
IPR007087 | 499 | 519 | PS00028 | Zinc finger | |
IPR007087 | 527 | 547 | PS00028 | Zinc finger | |
IPR007087 | 555 | 575 | PS00028 | Zinc finger | |
IPR007087 | 583 | 603 | PS00028 | Zinc finger | |
IPR007087 | 611 | 631 | PS00028 | Zinc finger | |
IPR007087 | 639 | 659 | PS00028 | Zinc finger | |
IPR007087 | 667 | 687 | PS00028 | Zinc finger | |
IPR007087 | 695 | 715 | PS00028 | Zinc finger | |
IPR007087 | 723 | 743 | PS00028 | Zinc finger |
![]() |
Primer_f | TGGAAAACCTCAGGAACCTAG |
---|---|
Primer_r | AAAGCTGATTCATCTAGTCGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |