Gene/Protein Characteristic Table for KIAA1852
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00932
Accession No AB058755
Description zinc finger protein 606
Clone name fj01514
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3952 bp)
Predicted protein sequence (948 aa)
Flexi ORF Clone FXC00932
Source Human fetal brain
Rouge ID mKIAA1852 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3952 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 952 bp
Genome contig ID gi42406306r_63080529
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
AATACATATAACACTTATGTGCTGGGCTTTCTTTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAATGCTTTCCAAGTGTTAACTTGTTTAGTCCCCTTTACTCTGAGATAGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 r 63180529 63206529 7 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 948 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8WXB4 0 100.0 Zinc finger pro...
 Homo sapiens
AAH37209 0 99.9 Zinc finger pro...
 Homo sapiens
XP_524432 0 99.4 zinc finger pro...
 Pan troglodytes
XP_001494744 0 93.4 similar to Zinc...
 Equus caballus
AAH52747 0 89.3 Zinc finger pro...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D31763 3.7e-66 42.8 KIAA0065
AB107355 6.4e-64 40.9 KIAA2033
AB037770 6e-63 45.2 KIAA1349
AB046831 1.1e-57 43.7 KIAA1611
AB075862 2.9e-56 47.2 KIAA1982
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 584 607 PD000003 Zinc finger
IPR007087 612 635 PD000003 Zinc finger
IPR007087 640 663 PD000003 Zinc finger
IPR007087 668 691 PD000003 Zinc finger
IPR007087 724 747 PD000003 Zinc finger
IPR007087 752 775 PD000003 Zinc finger
IPR007087 780 803 PD000003 Zinc finger
IPR007087 808 831 PD000003 Zinc finger
IPR007087 836 859 PD000003 Zinc finger
IPR007087 864 887 PD000003 Zinc finger
IPR007087 892 915 PD000003 Zinc finger
IPR007087 920 940 PD000003 Zinc finger
HMMPfam IPR001909 218 258 PF01352 KRAB box
IPR007087 584 606 PF00096 Zinc finger
IPR007087 612 634 PF00096 Zinc finger
IPR007087 640 662 PF00096 Zinc finger
IPR007087 668 690 PF00096 Zinc finger
IPR007087 696 718 PF00096 Zinc finger
IPR007087 724 746 PF00096 Zinc finger
IPR007087 752 774 PF00096 Zinc finger
IPR007087 780 802 PF00096 Zinc finger
IPR007087 808 830 PF00096 Zinc finger
IPR007087 836 858 PF00096 Zinc finger
IPR007087 864 886 PF00096 Zinc finger
IPR007087 892 914 PF00096 Zinc finger
IPR007087 920 942 PF00096 Zinc finger
HMMSmart IPR001909 218 278 SM00349 KRAB box
IPR015880 473 495 SM00355 Zinc finger
IPR015880 556 578 SM00355 Zinc finger
IPR015880 584 606 SM00355 Zinc finger
IPR015880 612 634 SM00355 Zinc finger
IPR015880 640 662 SM00355 Zinc finger
IPR015880 668 690 SM00355 Zinc finger
IPR015880 696 718 SM00355 Zinc finger
IPR015880 724 746 SM00355 Zinc finger
IPR015880 752 774 SM00355 Zinc finger
IPR015880 780 802 SM00355 Zinc finger
IPR015880 808 830 SM00355 Zinc finger
IPR015880 836 858 SM00355 Zinc finger
IPR015880 864 886 SM00355 Zinc finger
IPR015880 892 914 SM00355 Zinc finger
IPR015880 920 942 SM00355 Zinc finger
ProfileScan IPR001909 218 289 PS50805 KRAB box
IPR007087 445 472 PS50157 Zinc finger
IPR007087 473 500 PS50157 Zinc finger
IPR007087 556 583 PS50157 Zinc finger
IPR007087 584 611 PS50157 Zinc finger
IPR007087 612 639 PS50157 Zinc finger
IPR007087 640 667 PS50157 Zinc finger
IPR007087 668 695 PS50157 Zinc finger
IPR007087 696 723 PS50157 Zinc finger
IPR007087 724 751 PS50157 Zinc finger
IPR007087 752 779 PS50157 Zinc finger
IPR007087 780 807 PS50157 Zinc finger
IPR007087 808 835 PS50157 Zinc finger
IPR007087 836 863 PS50157 Zinc finger
IPR007087 864 891 PS50157 Zinc finger
IPR007087 892 919 PS50157 Zinc finger
IPR007087 920 947 PS50157 Zinc finger
ScanRegExp IPR007087 586 606 PS00028 Zinc finger
IPR007087 614 634 PS00028 Zinc finger
IPR007087 642 662 PS00028 Zinc finger
IPR007087 670 690 PS00028 Zinc finger
IPR007087 698 718 PS00028 Zinc finger
IPR007087 726 746 PS00028 Zinc finger
IPR007087 754 774 PS00028 Zinc finger
IPR007087 782 802 PS00028 Zinc finger
IPR007087 810 830 PS00028 Zinc finger
IPR007087 838 858 PS00028 Zinc finger
IPR007087 866 886 PS00028 Zinc finger
IPR007087 894 914 PS00028 Zinc finger
IPR007087 922 942 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCAGGAGTAGAATATGAAGTG
Primer_r TAACAATGGACGCTGACACAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name CCR
Primer_f CCAGGAGTAGAATATGAAGTG
Primer_r TAACAATGGACGCTGACACAC
PCR product length 95 bp
PCR conditions 15 °C62 sec60 °C30 sec201 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp