Order Kazusa clone(s) from : ![]() |
Product ID | ORK00932 |
---|---|
Accession No | AB058755 |
Description | zinc finger protein 606 |
Clone name | fj01514 |
Vector information | |
cDNA sequence | DNA sequence (3952 bp) Predicted protein sequence (948 aa) |
HaloTag ORF Clone |
FHC00932
![]() |
Flexi ORF Clone | FXC00932 |
Source | Human fetal brain |
Rouge ID |
mKIAA1852
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 952 bp |
---|---|
Genome contig ID | gi42406306r_63080529 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 63180529 | 63206529 | 7 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 584 | 607 | PD000003 | Zinc finger |
IPR007087 | 612 | 635 | PD000003 | Zinc finger | |
IPR007087 | 640 | 663 | PD000003 | Zinc finger | |
IPR007087 | 668 | 691 | PD000003 | Zinc finger | |
IPR007087 | 724 | 747 | PD000003 | Zinc finger | |
IPR007087 | 752 | 775 | PD000003 | Zinc finger | |
IPR007087 | 780 | 803 | PD000003 | Zinc finger | |
IPR007087 | 808 | 831 | PD000003 | Zinc finger | |
IPR007087 | 836 | 859 | PD000003 | Zinc finger | |
IPR007087 | 864 | 887 | PD000003 | Zinc finger | |
IPR007087 | 892 | 915 | PD000003 | Zinc finger | |
IPR007087 | 920 | 940 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 218 | 258 | PF01352 | KRAB box |
IPR007087 | 584 | 606 | PF00096 | Zinc finger | |
IPR007087 | 612 | 634 | PF00096 | Zinc finger | |
IPR007087 | 640 | 662 | PF00096 | Zinc finger | |
IPR007087 | 668 | 690 | PF00096 | Zinc finger | |
IPR007087 | 696 | 718 | PF00096 | Zinc finger | |
IPR007087 | 724 | 746 | PF00096 | Zinc finger | |
IPR007087 | 752 | 774 | PF00096 | Zinc finger | |
IPR007087 | 780 | 802 | PF00096 | Zinc finger | |
IPR007087 | 808 | 830 | PF00096 | Zinc finger | |
IPR007087 | 836 | 858 | PF00096 | Zinc finger | |
IPR007087 | 864 | 886 | PF00096 | Zinc finger | |
IPR007087 | 892 | 914 | PF00096 | Zinc finger | |
IPR007087 | 920 | 942 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 218 | 278 | SM00349 | KRAB box |
IPR015880 | 473 | 495 | SM00355 | Zinc finger | |
IPR015880 | 556 | 578 | SM00355 | Zinc finger | |
IPR015880 | 584 | 606 | SM00355 | Zinc finger | |
IPR015880 | 612 | 634 | SM00355 | Zinc finger | |
IPR015880 | 640 | 662 | SM00355 | Zinc finger | |
IPR015880 | 668 | 690 | SM00355 | Zinc finger | |
IPR015880 | 696 | 718 | SM00355 | Zinc finger | |
IPR015880 | 724 | 746 | SM00355 | Zinc finger | |
IPR015880 | 752 | 774 | SM00355 | Zinc finger | |
IPR015880 | 780 | 802 | SM00355 | Zinc finger | |
IPR015880 | 808 | 830 | SM00355 | Zinc finger | |
IPR015880 | 836 | 858 | SM00355 | Zinc finger | |
IPR015880 | 864 | 886 | SM00355 | Zinc finger | |
IPR015880 | 892 | 914 | SM00355 | Zinc finger | |
IPR015880 | 920 | 942 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 218 | 289 | PS50805 | KRAB box |
IPR007087 | 445 | 472 | PS50157 | Zinc finger | |
IPR007087 | 473 | 500 | PS50157 | Zinc finger | |
IPR007087 | 556 | 583 | PS50157 | Zinc finger | |
IPR007087 | 584 | 611 | PS50157 | Zinc finger | |
IPR007087 | 612 | 639 | PS50157 | Zinc finger | |
IPR007087 | 640 | 667 | PS50157 | Zinc finger | |
IPR007087 | 668 | 695 | PS50157 | Zinc finger | |
IPR007087 | 696 | 723 | PS50157 | Zinc finger | |
IPR007087 | 724 | 751 | PS50157 | Zinc finger | |
IPR007087 | 752 | 779 | PS50157 | Zinc finger | |
IPR007087 | 780 | 807 | PS50157 | Zinc finger | |
IPR007087 | 808 | 835 | PS50157 | Zinc finger | |
IPR007087 | 836 | 863 | PS50157 | Zinc finger | |
IPR007087 | 864 | 891 | PS50157 | Zinc finger | |
IPR007087 | 892 | 919 | PS50157 | Zinc finger | |
IPR007087 | 920 | 947 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 586 | 606 | PS00028 | Zinc finger |
IPR007087 | 614 | 634 | PS00028 | Zinc finger | |
IPR007087 | 642 | 662 | PS00028 | Zinc finger | |
IPR007087 | 670 | 690 | PS00028 | Zinc finger | |
IPR007087 | 698 | 718 | PS00028 | Zinc finger | |
IPR007087 | 726 | 746 | PS00028 | Zinc finger | |
IPR007087 | 754 | 774 | PS00028 | Zinc finger | |
IPR007087 | 782 | 802 | PS00028 | Zinc finger | |
IPR007087 | 810 | 830 | PS00028 | Zinc finger | |
IPR007087 | 838 | 858 | PS00028 | Zinc finger | |
IPR007087 | 866 | 886 | PS00028 | Zinc finger | |
IPR007087 | 894 | 914 | PS00028 | Zinc finger | |
IPR007087 | 922 | 942 | PS00028 | Zinc finger |
![]() |
Primer_f | CCAGGAGTAGAATATGAAGTG |
---|---|
Primer_r | TAACAATGGACGCTGACACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CCAGGAGTAGAATATGAAGTG |
Primer_r | TAACAATGGACGCTGACACAC |
PCR product length | 95 bp |
PCR conditions | 15 °C![]() ![]() ![]() ![]() |