| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00951 | 
|---|---|
| Accession No | AB075822 | 
| Description | glutamate-rich WD repeat containing 1 | 
| Clone name | fg00781 | 
| Vector information | |
| cDNA sequence | DNA sequence (5549 bp) Predicted protein sequence (445 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00951
     
     
     | 
| Flexi ORF Clone | FXC00951 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1942
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 5549 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 4210 bp | 
|---|---|
| Genome contig ID | gi42406306f_53541077 | 
| PolyA signal sequence (None)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (115522 - 115571)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 19 | f | 53641077 | 53656597 | 8 | 99.0 | Perfect prediction | 
 
        Length: 445 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| BlastProDom | IPR001680 | 256 | 290 | PD000018 | WD40 repeat | 
| FPrintScan | IPR001680 | 276 | 290 | PR00320 | WD40 repeat | 
| IPR001680 | 322 | 336 | PR00320 | WD40 repeat | |
| IPR001680 | 368 | 382 | PR00320 | WD40 repeat | |
| HMMPfam | IPR001680 | 203 | 242 | PF00400 | WD40 repeat | 
| IPR001680 | 250 | 289 | PF00400 | WD40 repeat | |
| IPR001680 | 297 | 335 | PF00400 | WD40 repeat | |
| IPR001680 | 342 | 381 | PF00400 | WD40 repeat | |
| HMMSmart | IPR001680 | 202 | 242 | SM00320 | WD40 repeat | 
| IPR001680 | 248 | 289 | SM00320 | WD40 repeat | |
| IPR001680 | 296 | 335 | SM00320 | WD40 repeat | |
| IPR001680 | 341 | 381 | SM00320 | WD40 repeat | |
| ProfileScan | IPR001680 | 209 | 390 | PS50294 | WD40 repeat | 
| IPR001680 | 256 | 291 | PS50082 | WD40 repeat | |
| IPR001680 | 303 | 337 | PS50082 | WD40 repeat | |
| IPR001680 | 348 | 382 | PS50082 | WD40 repeat | |
| ScanRegExp | IPR001680 | 322 | 336 | PS00678 | WD40 repeat | 
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | CAACAGACTGATGATGCTTCG | 
|---|---|
| Primer_r | GGTTTCCGCTCTTCTTCATCC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 19
 Experimental conditions| Panel name | genbank | 
|---|---|
| Primer_f | - | 
| Primer_r | - | 
| PCR product length | - | 
| PCR conditions | - |