Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00776 |
|---|---|
| Accession No | AB033068 |
| Description | fizzy/cell division cycle 20 related 1, transcript variant 2 |
| Clone name | fh10406 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (5008 bp) Predicted protein sequence (504 aa) |
|
HaloTag ORF Clone |
FHC00776
|
| Flexi ORF Clone | FXC00776 |
| Source | Human fetal brain |
Length: 5008 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3492 bp |
|---|---|
| Genome contig ID | gi42406306f_3373954 |
| PolyA signal sequence (AATACA,-20) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (115373 - 115422) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 19 | f | 3473954 | 3489325 | 13 | 99.3 | Perfect prediction |
Length: 504 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000002 | 171 | 229 | PD004563 | Cdc20/Fizzy |
| IPR001680 | 320 | 351 | PD000018 | WD40 repeat | |
| IPR001680 | 450 | 483 | PD000018 | WD40 repeat | |
| FPrintScan | IPR001680 | 339 | 353 | PR00320 | WD40 repeat |
| IPR001680 | 384 | 398 | PR00320 | WD40 repeat | |
| IPR001680 | 469 | 483 | PR00320 | WD40 repeat | |
| HMMPfam | IPR001680 | 230 | 268 | PF00400 | WD40 repeat |
| IPR001680 | 272 | 308 | PF00400 | WD40 repeat | |
| IPR001680 | 314 | 352 | PF00400 | WD40 repeat | |
| IPR001680 | 356 | 386 | PF00400 | WD40 repeat | |
| IPR001680 | 444 | 482 | PF00400 | WD40 repeat | |
| HMMSmart | IPR001680 | 229 | 268 | SM00320 | WD40 repeat |
| IPR001680 | 271 | 308 | SM00320 | WD40 repeat | |
| IPR001680 | 313 | 352 | SM00320 | WD40 repeat | |
| IPR001680 | 355 | 397 | SM00320 | WD40 repeat | |
| IPR001680 | 400 | 440 | SM00320 | WD40 repeat | |
| IPR001680 | 443 | 482 | SM00320 | WD40 repeat | |
| ProfileScan | IPR001680 | 236 | 277 | PS50082 | WD40 repeat |
| IPR001680 | 236 | 491 | PS50294 | WD40 repeat | |
| IPR001680 | 320 | 361 | PS50082 | WD40 repeat | |
| IPR001680 | 450 | 491 | PS50082 | WD40 repeat | |
| ScanRegExp | IPR001680 | 384 | 398 | PS00678 | WD40 repeat |
| IPR001680 | 469 | 483 | PS00678 | WD40 repeat |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 206 | WSSLNVLSVGLGTCVYLWSACTS | 228 | PRIMARY | 23 |
|---|
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GGAGTGTACGTCAGGCTTTGC |
|---|---|
| Primer_r | GCTACATTCCAGGATCAACAG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 19 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GGAGTGTACGTCAGGCTTTGC |
| Primer_r | GCTACATTCCAGGATCAACAG |
| PCR product length | 220 bp |
| PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |
Japan
||
Other countries
